Incidental Mutation 'R6648:Zmynd11'
ID 524376
Institutional Source Beutler Lab
Gene Symbol Zmynd11
Ensembl Gene ENSMUSG00000021156
Gene Name zinc finger, MYND domain containing 11
Synonyms 2210402G22Rik
MMRRC Submission 044769-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.650) question?
Stock # R6648 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 9734869-9815366 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 9763057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 95 (S95R)
Ref Sequence ENSEMBL: ENSMUSP00000118964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062658] [ENSMUST00000110633] [ENSMUST00000110634] [ENSMUST00000110635] [ENSMUST00000110636] [ENSMUST00000110637] [ENSMUST00000110638] [ENSMUST00000130151] [ENSMUST00000128658] [ENSMUST00000144642] [ENSMUST00000146039] [ENSMUST00000146059] [ENSMUST00000152725] [ENSMUST00000154994] [ENSMUST00000157035] [ENSMUST00000220996] [ENSMUST00000222358] [ENSMUST00000222475] [ENSMUST00000223421]
AlphaFold Q8R5C8
Predicted Effect probably benign
Transcript: ENSMUST00000062658
SMART Domains Protein: ENSMUSP00000059767
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110633
SMART Domains Protein: ENSMUSP00000106263
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 62 106 4.19e-7 SMART
RING 66 105 8.31e-1 SMART
BROMO 111 217 1.03e-18 SMART
PWWP 238 289 1.96e-21 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
coiled coil region 503 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110634
SMART Domains Protein: ENSMUSP00000106264
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110635
SMART Domains Protein: ENSMUSP00000106265
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 133 226 3.35e-4 SMART
PWWP 247 298 1.96e-21 SMART
low complexity region 341 354 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
coiled coil region 456 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110636
SMART Domains Protein: ENSMUSP00000106266
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110637
SMART Domains Protein: ENSMUSP00000106267
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110638
SMART Domains Protein: ENSMUSP00000106268
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
coiled coil region 489 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130151
AA Change: S95R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118964
Gene: ENSMUSG00000021156
AA Change: S95R

DomainStartEndE-ValueType
PHD 117 161 4.19e-7 SMART
RING 121 160 8.31e-1 SMART
BROMO 166 272 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128658
SMART Domains Protein: ENSMUSP00000121574
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 97 149 8e-32 BLAST
PDB:4N4I|A 99 149 6e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140180
Predicted Effect probably benign
Transcript: ENSMUST00000144642
SMART Domains Protein: ENSMUSP00000117375
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146039
SMART Domains Protein: ENSMUSP00000116299
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
SCOP:d1fp0a1 55 87 2e-6 SMART
PDB:4COS|A 59 87 6e-7 PDB
Blast:PHD 62 96 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146059
SMART Domains Protein: ENSMUSP00000122133
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 38 81 1e-23 BLAST
PDB:4N4I|A 59 89 2e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152725
SMART Domains Protein: ENSMUSP00000118002
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Blast:BROMO 151 203 8e-31 BLAST
PDB:4N4I|A 153 203 2e-27 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154994
SMART Domains Protein: ENSMUSP00000116635
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 249 1.59e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157035
Predicted Effect probably benign
Transcript: ENSMUST00000220996
Predicted Effect probably benign
Transcript: ENSMUST00000222358
Predicted Effect probably benign
Transcript: ENSMUST00000222475
Predicted Effect probably benign
Transcript: ENSMUST00000223421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222148
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,827,490 (GRCm39) Y511H probably damaging Het
Arhgef38 A T 3: 132,838,236 (GRCm39) I600N probably damaging Het
Cacna1g A T 11: 94,323,395 (GRCm39) C1270S probably damaging Het
Ccar2 T G 14: 70,376,674 (GRCm39) D890A probably benign Het
Cep76 A T 18: 67,752,804 (GRCm39) V548D probably benign Het
Chat T G 14: 32,176,651 (GRCm39) Q41P probably benign Het
Ddx24 T A 12: 103,374,634 (GRCm39) N850I probably benign Het
Dst A G 1: 34,301,122 (GRCm39) I5879V possibly damaging Het
Ece1 A G 4: 137,648,470 (GRCm39) T92A probably benign Het
Ecrg4 T A 1: 43,777,851 (GRCm39) F87I probably damaging Het
Fpgs G T 2: 32,574,799 (GRCm39) C439* probably null Het
H2-Q4 A T 17: 35,601,981 (GRCm39) E281V probably damaging Het
Hydin A G 8: 111,252,299 (GRCm39) probably null Het
Iqgap2 T C 13: 95,818,719 (GRCm39) E679G probably benign Het
Kif12 A T 4: 63,089,554 (GRCm39) probably null Het
Kif21b T C 1: 136,080,135 (GRCm39) V557A probably benign Het
Mki67 C G 7: 135,299,169 (GRCm39) S1955T probably damaging Het
Mybpc1 G A 10: 88,358,861 (GRCm39) T1110M probably damaging Het
Myh9 T C 15: 77,650,972 (GRCm39) H1625R probably benign Het
Nbeal2 G A 9: 110,466,710 (GRCm39) T704M probably damaging Het
Or1ad6 G A 11: 50,860,000 (GRCm39) D52N probably damaging Het
Or5a21 A T 19: 12,311,130 (GRCm39) M30K probably benign Het
Osbpl9 C A 4: 108,948,876 (GRCm39) Q91H possibly damaging Het
Pcsk5 A T 19: 17,553,185 (GRCm39) L665Q probably damaging Het
Pgm5 T C 19: 24,838,996 (GRCm39) D53G probably benign Het
Plcd4 A G 1: 74,591,172 (GRCm39) D189G probably benign Het
Plxnb1 A T 9: 108,933,398 (GRCm39) Q676L probably benign Het
Prss33 A G 17: 24,053,676 (GRCm39) S134P probably benign Het
Rln1 G T 19: 29,309,521 (GRCm39) T86K probably benign Het
Rnf213 G A 11: 119,370,746 (GRCm39) A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Sh3tc2 T C 18: 62,148,111 (GRCm39) C1274R probably benign Het
Slc35a5 A T 16: 44,964,280 (GRCm39) F318I probably damaging Het
Slc41a3 T C 6: 90,596,490 (GRCm39) F20L probably damaging Het
Socs4 T A 14: 47,527,633 (GRCm39) N189K probably benign Het
Tiam2 A T 17: 3,557,148 (GRCm39) E1196V probably damaging Het
Tmc3 T A 7: 83,246,751 (GRCm39) V164D probably damaging Het
Trim46 T C 3: 89,142,549 (GRCm39) E623G possibly damaging Het
Ubr4 C A 4: 139,180,030 (GRCm39) C3403* probably null Het
Vmn1r194 A T 13: 22,428,694 (GRCm39) T104S probably benign Het
Vmn2r112 A T 17: 22,837,467 (GRCm39) I643F probably damaging Het
Zfp1002 T C 2: 150,097,097 (GRCm39) I111V probably benign Het
Zswim4 C A 8: 84,957,543 (GRCm39) R175L probably benign Het
Other mutations in Zmynd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zmynd11 APN 13 9,739,262 (GRCm39) missense probably damaging 0.97
IGL00846:Zmynd11 APN 13 9,770,808 (GRCm39) critical splice donor site probably null
IGL01606:Zmynd11 APN 13 9,747,724 (GRCm39) missense probably damaging 1.00
IGL03229:Zmynd11 APN 13 9,739,601 (GRCm39) missense probably damaging 1.00
R1173:Zmynd11 UTSW 13 9,739,585 (GRCm39) missense probably damaging 1.00
R1413:Zmynd11 UTSW 13 9,760,256 (GRCm39) missense probably damaging 1.00
R1813:Zmynd11 UTSW 13 9,739,616 (GRCm39) missense possibly damaging 0.53
R1872:Zmynd11 UTSW 13 9,748,737 (GRCm39) missense possibly damaging 0.88
R2002:Zmynd11 UTSW 13 9,739,514 (GRCm39) splice site probably null
R2991:Zmynd11 UTSW 13 9,745,858 (GRCm39) missense probably damaging 0.99
R4273:Zmynd11 UTSW 13 9,747,726 (GRCm39) missense probably damaging 1.00
R4708:Zmynd11 UTSW 13 9,745,789 (GRCm39) missense probably damaging 0.97
R4718:Zmynd11 UTSW 13 9,739,603 (GRCm39) missense possibly damaging 0.86
R5011:Zmynd11 UTSW 13 9,739,479 (GRCm39) unclassified probably benign
R5151:Zmynd11 UTSW 13 9,740,953 (GRCm39) missense probably damaging 1.00
R5963:Zmynd11 UTSW 13 9,745,931 (GRCm39) intron probably benign
R7002:Zmynd11 UTSW 13 9,744,366 (GRCm39) missense probably damaging 1.00
R7223:Zmynd11 UTSW 13 9,760,198 (GRCm39) missense probably benign 0.09
R7322:Zmynd11 UTSW 13 9,740,445 (GRCm39) missense possibly damaging 0.53
R7462:Zmynd11 UTSW 13 9,748,720 (GRCm39) missense probably benign 0.29
R7500:Zmynd11 UTSW 13 9,785,434 (GRCm39) missense probably benign 0.00
R7737:Zmynd11 UTSW 13 9,745,175 (GRCm39) missense probably damaging 1.00
R8181:Zmynd11 UTSW 13 9,739,687 (GRCm39) missense probably benign 0.08
R8331:Zmynd11 UTSW 13 9,745,190 (GRCm39) missense probably benign 0.21
R8853:Zmynd11 UTSW 13 9,740,965 (GRCm39) missense probably damaging 0.99
R9115:Zmynd11 UTSW 13 9,743,495 (GRCm39) missense probably damaging 1.00
R9184:Zmynd11 UTSW 13 9,743,475 (GRCm39) missense probably benign 0.01
R9747:Zmynd11 UTSW 13 9,739,244 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGAGTTGATCTAAACAAGCAAGAG -3'
(R):5'- GCTCTTAAGTTTGCATGCTACTATC -3'

Sequencing Primer
(F):5'- ccaaaaccaaaaccaaacca -3'
(R):5'- CGTTGTCTGCCAAATAGT -3'
Posted On 2018-06-22