Incidental Mutation 'R6648:Zmynd11'
ID524376
Institutional Source Beutler Lab
Gene Symbol Zmynd11
Ensembl Gene ENSMUSG00000021156
Gene Namezinc finger, MYND domain containing 11
Synonyms2210402G22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location9684833-9765330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 9713021 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 95 (S95R)
Ref Sequence ENSEMBL: ENSMUSP00000118964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062658] [ENSMUST00000110633] [ENSMUST00000110634] [ENSMUST00000110635] [ENSMUST00000110636] [ENSMUST00000110637] [ENSMUST00000110638] [ENSMUST00000128658] [ENSMUST00000130151] [ENSMUST00000144642] [ENSMUST00000146039] [ENSMUST00000146059] [ENSMUST00000152725] [ENSMUST00000154994] [ENSMUST00000157035] [ENSMUST00000220996] [ENSMUST00000222358] [ENSMUST00000222475] [ENSMUST00000223421]
Predicted Effect probably benign
Transcript: ENSMUST00000062658
SMART Domains Protein: ENSMUSP00000059767
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110633
SMART Domains Protein: ENSMUSP00000106263
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 62 106 4.19e-7 SMART
RING 66 105 8.31e-1 SMART
BROMO 111 217 1.03e-18 SMART
PWWP 238 289 1.96e-21 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
coiled coil region 503 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110634
SMART Domains Protein: ENSMUSP00000106264
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110635
SMART Domains Protein: ENSMUSP00000106265
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 133 226 3.35e-4 SMART
PWWP 247 298 1.96e-21 SMART
low complexity region 341 354 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
coiled coil region 456 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110636
SMART Domains Protein: ENSMUSP00000106266
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110637
SMART Domains Protein: ENSMUSP00000106267
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110638
SMART Domains Protein: ENSMUSP00000106268
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
coiled coil region 489 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128658
SMART Domains Protein: ENSMUSP00000121574
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 97 149 8e-32 BLAST
PDB:4N4I|A 99 149 6e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130151
AA Change: S95R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118964
Gene: ENSMUSG00000021156
AA Change: S95R

DomainStartEndE-ValueType
PHD 117 161 4.19e-7 SMART
RING 121 160 8.31e-1 SMART
BROMO 166 272 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140180
Predicted Effect probably benign
Transcript: ENSMUST00000144642
SMART Domains Protein: ENSMUSP00000117375
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146039
SMART Domains Protein: ENSMUSP00000116299
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
SCOP:d1fp0a1 55 87 2e-6 SMART
PDB:4COS|A 59 87 6e-7 PDB
Blast:PHD 62 96 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146059
SMART Domains Protein: ENSMUSP00000122133
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 38 81 1e-23 BLAST
PDB:4N4I|A 59 89 2e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152725
SMART Domains Protein: ENSMUSP00000118002
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Blast:BROMO 151 203 8e-31 BLAST
PDB:4N4I|A 153 203 2e-27 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154994
SMART Domains Protein: ENSMUSP00000116635
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 249 1.59e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157035
Predicted Effect probably benign
Transcript: ENSMUST00000220996
Predicted Effect probably benign
Transcript: ENSMUST00000222358
Predicted Effect probably benign
Transcript: ENSMUST00000222475
Predicted Effect probably benign
Transcript: ENSMUST00000223421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222148
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Zmynd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zmynd11 APN 13 9689226 missense probably damaging 0.97
IGL00846:Zmynd11 APN 13 9720772 critical splice donor site probably null
IGL01606:Zmynd11 APN 13 9697688 missense probably damaging 1.00
IGL03229:Zmynd11 APN 13 9689565 missense probably damaging 1.00
R1173:Zmynd11 UTSW 13 9689549 missense probably damaging 1.00
R1413:Zmynd11 UTSW 13 9710220 missense probably damaging 1.00
R1813:Zmynd11 UTSW 13 9689580 missense possibly damaging 0.53
R1872:Zmynd11 UTSW 13 9698701 missense possibly damaging 0.88
R2002:Zmynd11 UTSW 13 9689478 splice site probably null
R2991:Zmynd11 UTSW 13 9695822 missense probably damaging 0.99
R4273:Zmynd11 UTSW 13 9697690 missense probably damaging 1.00
R4708:Zmynd11 UTSW 13 9695753 missense probably damaging 0.97
R4718:Zmynd11 UTSW 13 9689567 missense possibly damaging 0.86
R5011:Zmynd11 UTSW 13 9689443 unclassified probably benign
R5151:Zmynd11 UTSW 13 9690917 missense probably damaging 1.00
R5963:Zmynd11 UTSW 13 9695895 intron probably benign
R7002:Zmynd11 UTSW 13 9694330 missense probably damaging 1.00
R7223:Zmynd11 UTSW 13 9710162 missense probably benign 0.09
R7322:Zmynd11 UTSW 13 9690409 missense possibly damaging 0.53
R7462:Zmynd11 UTSW 13 9698684 missense probably benign 0.29
R7500:Zmynd11 UTSW 13 9735398 missense probably benign 0.00
R7737:Zmynd11 UTSW 13 9695139 missense probably damaging 1.00
R8181:Zmynd11 UTSW 13 9689651 missense probably benign 0.08
R8331:Zmynd11 UTSW 13 9695154 missense probably benign 0.21
R8853:Zmynd11 UTSW 13 9690929 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAGTTGATCTAAACAAGCAAGAG -3'
(R):5'- GCTCTTAAGTTTGCATGCTACTATC -3'

Sequencing Primer
(F):5'- ccaaaaccaaaaccaaacca -3'
(R):5'- CGTTGTCTGCCAAATAGT -3'
Posted On2018-06-22