Incidental Mutation 'R6648:H2-Q4'
ID524398
Institutional Source Beutler Lab
Gene Symbol H2-Q4
Ensembl Gene ENSMUSG00000035929
Gene Namehistocompatibility 2, Q region locus 4
SynonymsH2-Gs10, Qa-4, Qb1, Qb-1, H-2Q4, Qa4, Qat-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6648 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35379617-35385290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35383005 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 281 (E281V)
Ref Sequence ENSEMBL: ENSMUSP00000080159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081435]
Predicted Effect probably damaging
Transcript: ENSMUST00000081435
AA Change: E281V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080159
Gene: ENSMUSG00000035929
AA Change: E281V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 50 228 1.7e-93 PFAM
IGc1 247 318 8.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173975
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: This locus controls an antigen on peripheral T-cells of spleen, lymph node and bone marrow, but not on thymocytes. Strain distribution patterns vary by assay, measuring presence/absence of antigen, protein acidic/basic qualities and molecular polymorphisms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in H2-Q4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:H2-Q4 APN 17 35382858 missense probably damaging 1.00
IGL01341:H2-Q4 APN 17 35383002 missense probably damaging 1.00
IGL01538:H2-Q4 APN 17 35383312 missense probably benign 0.03
IGL03258:H2-Q4 APN 17 35380119 missense probably benign 0.29
FR4304:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4340:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4342:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4589:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
LCD18:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
R1655:H2-Q4 UTSW 17 35382905 missense probably damaging 1.00
R1887:H2-Q4 UTSW 17 35380137 missense possibly damaging 0.94
R2013:H2-Q4 UTSW 17 35380550 missense probably damaging 1.00
R2073:H2-Q4 UTSW 17 35380402 missense possibly damaging 0.61
R2403:H2-Q4 UTSW 17 35379997 missense probably damaging 0.99
R3813:H2-Q4 UTSW 17 35383095 missense possibly damaging 0.79
R3928:H2-Q4 UTSW 17 35379690 missense unknown
R5076:H2-Q4 UTSW 17 35380441 missense probably damaging 1.00
R5096:H2-Q4 UTSW 17 35379713 splice site probably benign
R5252:H2-Q4 UTSW 17 35380435 missense probably benign 0.00
R5318:H2-Q4 UTSW 17 35383311 missense possibly damaging 0.48
R5618:H2-Q4 UTSW 17 35379925 missense probably damaging 1.00
R7351:H2-Q4 UTSW 17 35382878 missense possibly damaging 0.65
R7846:H2-Q4 UTSW 17 35380158 missense probably damaging 0.99
R7929:H2-Q4 UTSW 17 35380158 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATTTCTTAAATCTTCCACACAG -3'
(R):5'- ACGTTCGCCATGTTGGAGAC -3'

Sequencing Primer
(F):5'- GATCCTCCAAAGGCACATGTG -3'
(R):5'- TCAGGGTCTGCAAAAGGCTC -3'
Posted On2018-06-22