Incidental Mutation 'R6648:Aars2'
ID524400
Institutional Source Beutler Lab
Gene Symbol Aars2
Ensembl Gene ENSMUSG00000023938
Gene Namealanyl-tRNA synthetase 2, mitochondrial
SynonymsAarsl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45506841-45520842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45516564 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 511 (Y511H)
Ref Sequence ENSEMBL: ENSMUSP00000024733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024733]
Predicted Effect probably damaging
Transcript: ENSMUST00000024733
AA Change: Y511H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: Y511H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:tRNA-synt_2c 36 619 4e-175 PFAM
low complexity region 663 674 N/A INTRINSIC
tRNA_SAD 716 774 2.65e-10 SMART
coiled coil region 833 863 N/A INTRINSIC
Meta Mutation Damage Score 0.6188 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Aars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Aars2 APN 17 45518172 missense probably benign 0.00
dread_pirate UTSW 17 45516564 missense probably damaging 1.00
R0266:Aars2 UTSW 17 45507510 splice site probably benign
R0315:Aars2 UTSW 17 45515452 missense possibly damaging 0.67
R0375:Aars2 UTSW 17 45514550 missense probably damaging 0.99
R0629:Aars2 UTSW 17 45507547 missense probably damaging 0.99
R0981:Aars2 UTSW 17 45520331 missense probably damaging 1.00
R1878:Aars2 UTSW 17 45514638 critical splice donor site probably null
R1893:Aars2 UTSW 17 45514799 missense probably benign 0.14
R2035:Aars2 UTSW 17 45514801 missense possibly damaging 0.87
R2099:Aars2 UTSW 17 45506894 missense unknown
R4342:Aars2 UTSW 17 45516495 missense probably benign
R4600:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4601:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4610:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R5158:Aars2 UTSW 17 45514829 missense probably benign 0.07
R5943:Aars2 UTSW 17 45517711 missense probably benign 0.30
R5992:Aars2 UTSW 17 45508623 nonsense probably null
R6255:Aars2 UTSW 17 45514609 missense probably damaging 1.00
R6381:Aars2 UTSW 17 45518545 missense probably benign 0.04
R6392:Aars2 UTSW 17 45514600 missense probably damaging 0.98
R6406:Aars2 UTSW 17 45506939 missense probably benign 0.16
R7135:Aars2 UTSW 17 45508961 nonsense probably null
R7197:Aars2 UTSW 17 45508959 missense probably damaging 1.00
R7203:Aars2 UTSW 17 45516571 missense probably damaging 1.00
R7289:Aars2 UTSW 17 45507624 missense probably damaging 0.99
R7669:Aars2 UTSW 17 45520295 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTTCTCTGTGCACCTGACAC -3'
(R):5'- GATTTATCAGTGTTAGGGCCCC -3'

Sequencing Primer
(F):5'- GTGCACCTGACACCCCCTC -3'
(R):5'- CCCCGGGGATGTGATGATG -3'
Posted On2018-06-22