Incidental Mutation 'R6648:Sh3tc2'
ID524402
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene NameSH3 domain and tetratricopeptide repeats 2
SynonymsD430044G18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6648 (G1)
Quality Score157.009
Status Validated
Chromosome18
Chromosomal Location61953075-62015715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62015040 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1274 (C1274R)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
Predicted Effect probably benign
Transcript: ENSMUST00000051720
AA Change: C1274R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: C1274R

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1636:Sh3tc2 UTSW 18 61989721 missense probably damaging 0.98
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5948:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6309:Sh3tc2 UTSW 18 61968010 missense probably damaging 0.98
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
R7211:Sh3tc2 UTSW 18 61989403 missense probably benign
R7367:Sh3tc2 UTSW 18 61989506 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGACTTAAGCCTGTCCTGCAG -3'
(R):5'- AAGATGCCTCTCACAGAGCC -3'

Sequencing Primer
(F):5'- AGGTATTGCTAATGATGTCTCTCC -3'
(R):5'- ACAGAGCCCTTCTCCTTCTGG -3'
Posted On2018-06-22