Incidental Mutation 'R6648:Cep76'
ID524404
Institutional Source Beutler Lab
Gene Symbol Cep76
Ensembl Gene ENSMUSG00000073542
Gene Namecentrosomal protein 76
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location67617397-67641336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67619734 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 548 (V548D)
Ref Sequence ENSEMBL: ENSMUSP00000095149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097542]
Predicted Effect probably benign
Transcript: ENSMUST00000097542
AA Change: V548D

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095149
Gene: ENSMUSG00000073542
AA Change: V548D

DomainStartEndE-ValueType
Pfam:CEP76-C2 99 258 4.1e-64 PFAM
low complexity region 383 393 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Blast:KIND 604 654 2e-27 BLAST
Meta Mutation Damage Score 0.1265 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Ccar2 T G 14: 70,139,225 D890A probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Cep76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Cep76 APN 18 67640117 missense probably benign 0.01
IGL01344:Cep76 APN 18 67623397 missense possibly damaging 0.95
IGL02426:Cep76 APN 18 67634917 missense probably benign
IGL02544:Cep76 APN 18 67634950 splice site probably benign
IGL02711:Cep76 APN 18 67638336 missense probably benign
IGL03283:Cep76 APN 18 67640069 missense possibly damaging 0.76
R0117:Cep76 UTSW 18 67626674 missense possibly damaging 0.91
R0450:Cep76 UTSW 18 67634780 missense probably benign 0.30
R0469:Cep76 UTSW 18 67634780 missense probably benign 0.30
R0587:Cep76 UTSW 18 67623175 nonsense probably null
R0658:Cep76 UTSW 18 67623304 missense probably damaging 1.00
R0667:Cep76 UTSW 18 67634778 missense possibly damaging 0.85
R1508:Cep76 UTSW 18 67623288 missense probably damaging 1.00
R1511:Cep76 UTSW 18 67624958 missense probably benign
R4280:Cep76 UTSW 18 67640159 missense probably benign 0.39
R4355:Cep76 UTSW 18 67626640 missense probably benign 0.02
R4702:Cep76 UTSW 18 67634898 missense possibly damaging 0.48
R4847:Cep76 UTSW 18 67619569 missense probably benign 0.04
R5650:Cep76 UTSW 18 67625066 missense probably damaging 1.00
R5897:Cep76 UTSW 18 67638328 missense probably benign 0.00
R7193:Cep76 UTSW 18 67641134 missense possibly damaging 0.70
R7822:Cep76 UTSW 18 67641149 nonsense probably null
R7846:Cep76 UTSW 18 67629905 missense probably damaging 1.00
R8870:Cep76 UTSW 18 67640120 missense probably benign 0.02
R8883:Cep76 UTSW 18 67633470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAAGTGGCAAATGCACGC -3'
(R):5'- CCATTTCTAGGCATACATTCTAGTG -3'

Sequencing Primer
(F):5'- CGCCTTGCATTTCTATACACAAAATG -3'
(R):5'- CTAGGCATACATTCTAGTGAGCTG -3'
Posted On2018-06-22