Incidental Mutation 'R6586:Fah'
ID 524405
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Name fumarylacetoacetate hydrolase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6586 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 84585159-84606722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84593260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 280 (D280V)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865] [ENSMUST00000128460]
AlphaFold P35505
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032865
AA Change: D280V

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: D280V

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128460
SMART Domains Protein: ENSMUSP00000121439
Gene: ENSMUSG00000030630

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 1 48 7.2e-10 PFAM
Pfam:FAA_hydrolase 53 140 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209112
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,328 F265L possibly damaging Het
9930022D16Rik A G 11: 109,417,960 T51A unknown Het
Acaa1a A G 9: 119,349,538 probably null Het
Clasp2 T C 9: 113,813,264 S280P probably damaging Het
Cnga3 T C 1: 37,261,278 S398P probably damaging Het
Cngb3 T G 4: 19,280,946 L5R probably damaging Het
Cyp2c65 T C 19: 39,082,218 F282L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnm2 T C 9: 21,505,646 F825S probably benign Het
Dusp27 T C 1: 166,100,885 E386G possibly damaging Het
Egfem1 T A 3: 29,662,411 C343* probably null Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Flg A T 3: 93,292,983 probably benign Het
Flnb A G 14: 7,929,138 R1956G possibly damaging Het
Mterf2 A G 10: 85,120,106 F218S probably damaging Het
Nlrp1a A G 11: 71,106,073 V868A probably benign Het
Nrip2 T A 6: 128,404,948 C85* probably null Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr620 T A 7: 103,611,976 I126F possibly damaging Het
Palm A C 10: 79,809,531 N111H probably benign Het
Pipox T C 11: 77,881,179 D373G possibly damaging Het
Plec C T 15: 76,175,087 G3540D probably damaging Het
Psd3 T C 8: 67,963,545 T567A probably damaging Het
Psg28 T C 7: 18,430,544 Y81C probably damaging Het
Rarres1 A T 3: 67,491,033 N131K probably damaging Het
Rbbp8nl G A 2: 180,280,959 H214Y probably damaging Het
Tas2r135 A G 6: 42,406,018 T164A probably benign Het
Tmco3 G T 8: 13,320,894 probably benign Het
Tnpo2 T A 8: 85,045,202 M259K possibly damaging Het
Tns4 T C 11: 99,080,267 R206G probably benign Het
Trim60 G T 8: 65,000,596 L334I possibly damaging Het
Ttn T C 2: 76,730,410 T29216A probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn1r60 T A 7: 5,544,447 N218I probably benign Het
Vps25 T G 11: 101,259,009 V125G probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Ythdf2 A T 4: 132,205,600 M83K probably benign Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84589629 missense probably benign 0.33
IGL02374:Fah APN 7 84605701 missense probably benign 0.02
IGL02975:Fah APN 7 84601079 missense probably benign 0.00
IGL03403:Fah APN 7 84593209 missense probably damaging 1.00
R0245:Fah UTSW 7 84595498 missense probably benign
R0689:Fah UTSW 7 84593184 critical splice donor site probably null
R1173:Fah UTSW 7 84601136 start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84593212 missense probably damaging 0.99
R1995:Fah UTSW 7 84602181 missense probably damaging 1.00
R2150:Fah UTSW 7 84594834 missense probably damaging 1.00
R3612:Fah UTSW 7 84585290 missense probably damaging 0.98
R3620:Fah UTSW 7 84588951 splice site probably null
R4360:Fah UTSW 7 84589648 missense probably damaging 1.00
R4386:Fah UTSW 7 84599136 missense probably damaging 1.00
R4923:Fah UTSW 7 84602052 intron probably benign
R5151:Fah UTSW 7 84601051 missense possibly damaging 0.87
R5443:Fah UTSW 7 84592396 missense probably damaging 0.96
R5470:Fah UTSW 7 84593185 critical splice donor site probably null
R5976:Fah UTSW 7 84594741 missense probably benign 0.00
R6086:Fah UTSW 7 84588912 missense probably damaging 1.00
R6272:Fah UTSW 7 84595545 missense probably damaging 1.00
R6502:Fah UTSW 7 84594835 missense probably damaging 1.00
R7522:Fah UTSW 7 84597074 missense probably benign 0.00
R7832:Fah UTSW 7 84595478 missense probably damaging 1.00
R8535:Fah UTSW 7 84601097 missense probably benign
R8823:Fah UTSW 7 84605717 missense possibly damaging 0.85
RF002:Fah UTSW 7 84589628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTCCACCCAGCAATGCTC -3'
(R):5'- CTGAAGCATTGTTACTTCCTGTG -3'

Sequencing Primer
(F):5'- AATGCTCAGGATCCGCTG -3'
(R):5'- CATCAGCTTATTTTCTCAAGTGTGG -3'
Posted On 2018-06-22