Incidental Mutation 'R6621:Ankrd34a'
ID524425
Institutional Source Beutler Lab
Gene Symbol Ankrd34a
Ensembl Gene ENSMUSG00000049097
Gene Nameankyrin repeat domain 34A
SynonymsAnkrd34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6621 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96596636-96599775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96598215 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 245 (N245S)
Ref Sequence ENSEMBL: ENSMUSP00000102707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058943] [ENSMUST00000062058] [ENSMUST00000091924] [ENSMUST00000145001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058943
AA Change: N245S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102707
Gene: ENSMUSG00000049097
AA Change: N245S

DomainStartEndE-ValueType
ANK 4 33 9.05e2 SMART
ANK 37 72 2.81e-4 SMART
ANK 76 106 5.84e-2 SMART
ANK 110 139 7.99e2 SMART
low complexity region 216 244 N/A INTRINSIC
low complexity region 350 366 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062058
SMART Domains Protein: ENSMUSP00000057623
Gene: ENSMUSG00000049288

DomainStartEndE-ValueType
Pfam:LIX1 80 328 8.9e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091924
SMART Domains Protein: ENSMUSP00000089544
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 217 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145001
SMART Domains Protein: ENSMUSP00000118943
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 148 4.4e-31 PFAM
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,423 T30M possibly damaging Het
Abcb8 T C 5: 24,394,510 F8L probably benign Het
Akap13 G T 7: 75,569,981 C44F probably damaging Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Chat C T 14: 32,419,013 A476T probably damaging Het
Cpsf1 T C 15: 76,603,519 D100G probably damaging Het
Cpt1a T A 19: 3,378,472 F615L probably damaging Het
Dpp4 T A 2: 62,352,140 D599V probably damaging Het
Dpysl5 T C 5: 30,784,469 probably null Het
Fam234a A G 17: 26,213,881 L460P probably damaging Het
Fsip2 T G 2: 82,989,814 V5297G possibly damaging Het
Gm28363 A G 1: 117,727,357 D102G probably benign Het
Greb1 A G 12: 16,692,717 V1377A probably damaging Het
Hat1 T A 2: 71,421,715 F264I probably benign Het
Kif3a A G 11: 53,579,130 I152M probably damaging Het
Lemd2 T C 17: 27,195,392 S323G probably benign Het
Manea T C 4: 26,340,363 probably null Het
Mcm9 T C 10: 53,563,313 E588G probably damaging Het
Mllt3 T G 4: 87,840,797 K338T possibly damaging Het
Nrxn1 T C 17: 90,162,182 T1324A probably damaging Het
Nudt8 T A 19: 4,001,320 Y64N probably benign Het
Olfr1137 A G 2: 87,711,555 V117A probably benign Het
Olfr1387 A G 11: 49,459,771 I31V probably benign Het
Olfr194 A T 16: 59,119,924 W49R probably benign Het
Olfr25 A T 9: 38,330,462 I289F probably damaging Het
Olfr60 A G 7: 140,345,455 F178S probably damaging Het
Olfr615 A G 7: 103,560,878 T134A possibly damaging Het
Osm T A 11: 4,239,541 D108E probably benign Het
Pde8a A G 7: 81,293,130 probably null Het
Phtf2 T C 5: 20,812,956 probably benign Het
Rnf214 T C 9: 45,896,170 D245G probably damaging Het
Slc10a7 T C 8: 78,515,634 I50T probably damaging Het
Slc5a6 A G 5: 31,040,778 V251A probably damaging Het
Sun3 T A 11: 9,016,242 T320S probably damaging Het
Zfp174 A G 16: 3,847,955 E28G probably damaging Het
Other mutations in Ankrd34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Ankrd34a APN 3 96598913 missense probably benign 0.33
R0190:Ankrd34a UTSW 3 96597789 missense probably damaging 0.99
R1940:Ankrd34a UTSW 3 96598676 missense probably benign 0.28
R3779:Ankrd34a UTSW 3 96598931 missense possibly damaging 0.85
R5427:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5429:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5430:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R6129:Ankrd34a UTSW 3 96597958 nonsense probably null
R6891:Ankrd34a UTSW 3 96598019 missense probably benign 0.00
R6951:Ankrd34a UTSW 3 96598422 missense possibly damaging 0.77
R7085:Ankrd34a UTSW 3 96598629 missense probably benign
R7478:Ankrd34a UTSW 3 96598500 missense possibly damaging 0.65
R8257:Ankrd34a UTSW 3 96597729 missense possibly damaging 0.93
R8746:Ankrd34a UTSW 3 96597475 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCCAACTGCAGACTGC -3'
(R):5'- AGGAAGACCAGACTCCTGAG -3'

Sequencing Primer
(F):5'- CAGACTGCAGGAGGAGGGC -3'
(R):5'- ACCAGACTCCTGAGCCTCG -3'
Posted On2018-06-22