Incidental Mutation 'R6586:Mterf2'
ID 524426
Institutional Source Beutler Lab
Gene Symbol Mterf2
Ensembl Gene ENSMUSG00000049038
Gene Name mitochondrial transcription termination factor 2
Synonyms Mterfd3, 1700007D05Rik
MMRRC Submission 044710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6586 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84955297-84963891 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84955970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 218 (F218S)
Ref Sequence ENSEMBL: ENSMUSP00000062762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050813] [ENSMUST00000095383] [ENSMUST00000214193] [ENSMUST00000214607] [ENSMUST00000216771] [ENSMUST00000217027]
AlphaFold Q8BKY8
Predicted Effect probably damaging
Transcript: ENSMUST00000050813
AA Change: F218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062762
Gene: ENSMUSG00000049038
AA Change: F218S

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Blast:Mterf 60 90 2e-7 BLAST
Blast:Mterf 95 126 1e-10 BLAST
Mterf 130 162 5.31e2 SMART
Blast:Mterf 167 197 8e-10 BLAST
Mterf 210 240 2.12e2 SMART
Mterf 282 312 8.02e-2 SMART
Mterf 313 343 1.02e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095383
SMART Domains Protein: ENSMUSP00000093030
Gene: ENSMUSG00000060935

DomainStartEndE-ValueType
Pfam:UPF0444 24 114 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214193
Predicted Effect probably benign
Transcript: ENSMUST00000214607
Predicted Effect probably benign
Transcript: ENSMUST00000216771
Predicted Effect probably benign
Transcript: ENSMUST00000217027
Meta Mutation Damage Score 0.8211 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele gain less weight than wild-type controls, develop a myopathy, and show memory deficits, decreased levels of mitochondrial transcripts, an imbalanced tRNA pool, impaired oxidative phosphorylation, reduced respiratory function, and enlarged mitochondrial mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,182,639 (GRCm39) F265L possibly damaging Het
9930022D16Rik A G 11: 109,308,786 (GRCm39) T51A unknown Het
Acaa1a A G 9: 119,178,604 (GRCm39) probably null Het
Clasp2 T C 9: 113,642,332 (GRCm39) S280P probably damaging Het
Cnga3 T C 1: 37,300,359 (GRCm39) S398P probably damaging Het
Cngb3 T G 4: 19,280,946 (GRCm39) L5R probably damaging Het
Cyp2c65 T C 19: 39,070,662 (GRCm39) F282L possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dnm2 T C 9: 21,416,942 (GRCm39) F825S probably benign Het
Egfem1 T A 3: 29,716,560 (GRCm39) C343* probably null Het
Fah T A 7: 84,242,468 (GRCm39) D280V probably benign Het
Fiz1 C T 7: 5,011,400 (GRCm39) A373T possibly damaging Het
Flg A T 3: 93,200,290 (GRCm39) probably benign Het
Flnb A G 14: 7,929,138 (GRCm38) R1956G possibly damaging Het
Nlrp1a A G 11: 70,996,899 (GRCm39) V868A probably benign Het
Nrip2 T A 6: 128,381,911 (GRCm39) C85* probably null Het
Ogfrl1 T G 1: 23,408,944 (GRCm39) K427N probably benign Het
Or1o1 G A 17: 37,716,796 (GRCm39) R119H probably benign Het
Or51v14 T A 7: 103,261,183 (GRCm39) I126F possibly damaging Het
Palm A C 10: 79,645,365 (GRCm39) N111H probably benign Het
Pipox T C 11: 77,772,005 (GRCm39) D373G possibly damaging Het
Plec C T 15: 76,059,287 (GRCm39) G3540D probably damaging Het
Psd3 T C 8: 68,416,197 (GRCm39) T567A probably damaging Het
Psg28 T C 7: 18,164,469 (GRCm39) Y81C probably damaging Het
Rarres1 A T 3: 67,398,366 (GRCm39) N131K probably damaging Het
Rbbp8nl G A 2: 179,922,752 (GRCm39) H214Y probably damaging Het
Styxl2 T C 1: 165,928,454 (GRCm39) E386G possibly damaging Het
Tas2r135 A G 6: 42,382,952 (GRCm39) T164A probably benign Het
Tmco3 G T 8: 13,370,894 (GRCm39) probably benign Het
Tnpo2 T A 8: 85,771,831 (GRCm39) M259K possibly damaging Het
Tns4 T C 11: 98,971,093 (GRCm39) R206G probably benign Het
Trim60 G T 8: 65,453,248 (GRCm39) L334I possibly damaging Het
Ttn T C 2: 76,560,754 (GRCm39) T29216A probably damaging Het
Urb2 G T 8: 124,757,864 (GRCm39) E1190D probably damaging Het
Vmn1r60 T A 7: 5,547,446 (GRCm39) N218I probably benign Het
Vps25 T G 11: 101,149,835 (GRCm39) V125G probably damaging Het
Ythdc2 A G 18: 44,978,855 (GRCm39) D455G probably benign Het
Ythdf2 A T 4: 131,932,911 (GRCm39) M83K probably benign Het
Other mutations in Mterf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Mterf2 APN 10 84,955,677 (GRCm39) missense probably damaging 0.97
IGL02553:Mterf2 APN 10 84,956,331 (GRCm39) missense probably damaging 0.99
IGL02851:Mterf2 APN 10 84,955,878 (GRCm39) missense probably damaging 0.97
IGL02861:Mterf2 APN 10 84,956,195 (GRCm39) missense probably damaging 0.98
IGL03111:Mterf2 APN 10 84,955,786 (GRCm39) nonsense probably null
IGL03169:Mterf2 APN 10 84,956,324 (GRCm39) missense probably benign 0.02
R0941:Mterf2 UTSW 10 84,955,934 (GRCm39) missense possibly damaging 0.74
R2241:Mterf2 UTSW 10 84,956,180 (GRCm39) missense possibly damaging 0.57
R3825:Mterf2 UTSW 10 84,956,147 (GRCm39) missense probably damaging 1.00
R4964:Mterf2 UTSW 10 84,955,979 (GRCm39) missense probably damaging 1.00
R5015:Mterf2 UTSW 10 84,955,596 (GRCm39) missense probably benign 0.00
R7032:Mterf2 UTSW 10 84,956,527 (GRCm39) nonsense probably null
R7405:Mterf2 UTSW 10 84,956,360 (GRCm39) missense probably damaging 1.00
R7705:Mterf2 UTSW 10 84,956,381 (GRCm39) missense probably damaging 1.00
R8079:Mterf2 UTSW 10 84,956,027 (GRCm39) missense probably damaging 1.00
R9375:Mterf2 UTSW 10 84,956,327 (GRCm39) missense probably damaging 1.00
R9626:Mterf2 UTSW 10 84,956,295 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATTTCACAACTAACTGTCG -3'
(R):5'- TTTCAAGAGCTGGGACTCAG -3'

Sequencing Primer
(F):5'- ACTGTCGTAGGTCATAGTCTGTACAC -3'
(R):5'- TTTCAAGAGCTGGGACTCAGAAATG -3'
Posted On 2018-06-22