Incidental Mutation 'R6586:Pipox'
ID524430
Institutional Source Beutler Lab
Gene Symbol Pipox
Ensembl Gene ENSMUSG00000017453
Gene Namepipecolic acid oxidase
SynonymsPso
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6586 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77880615-77894096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77881179 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 373 (D373G)
Ref Sequence ENSEMBL: ENSMUSP00000017597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017597
AA Change: D373G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017597
Gene: ENSMUSG00000017453
AA Change: D373G

DomainStartEndE-ValueType
Pfam:DAO 9 364 3.1e-49 PFAM
Pfam:NAD_binding_8 12 54 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155401
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,328 F265L possibly damaging Het
9930022D16Rik A G 11: 109,417,960 T51A unknown Het
Acaa1a A G 9: 119,349,538 probably null Het
Clasp2 T C 9: 113,813,264 S280P probably damaging Het
Cnga3 T C 1: 37,261,278 S398P probably damaging Het
Cngb3 T G 4: 19,280,946 L5R probably damaging Het
Cyp2c65 T C 19: 39,082,218 F282L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnm2 T C 9: 21,505,646 F825S probably benign Het
Dusp27 T C 1: 166,100,885 E386G possibly damaging Het
Egfem1 T A 3: 29,662,411 C343* probably null Het
Fah T A 7: 84,593,260 D280V probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Flg A T 3: 93,292,983 probably benign Het
Flnb A G 14: 7,929,138 R1956G possibly damaging Het
Mterf2 A G 10: 85,120,106 F218S probably damaging Het
Nlrp1a A G 11: 71,106,073 V868A probably benign Het
Nrip2 T A 6: 128,404,948 C85* probably null Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr620 T A 7: 103,611,976 I126F possibly damaging Het
Palm A C 10: 79,809,531 N111H probably benign Het
Plec C T 15: 76,175,087 G3540D probably damaging Het
Psd3 T C 8: 67,963,545 T567A probably damaging Het
Psg28 T C 7: 18,430,544 Y81C probably damaging Het
Rarres1 A T 3: 67,491,033 N131K probably damaging Het
Rbbp8nl G A 2: 180,280,959 H214Y probably damaging Het
Tas2r135 A G 6: 42,406,018 T164A probably benign Het
Tmco3 G T 8: 13,320,894 probably benign Het
Tnpo2 T A 8: 85,045,202 M259K possibly damaging Het
Tns4 T C 11: 99,080,267 R206G probably benign Het
Trim60 G T 8: 65,000,596 L334I possibly damaging Het
Ttn T C 2: 76,730,410 T29216A probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn1r60 T A 7: 5,544,447 N218I probably benign Het
Vps25 T G 11: 101,259,009 V125G probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Ythdf2 A T 4: 132,205,600 M83K probably benign Het
Other mutations in Pipox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Pipox APN 11 77883193 missense probably damaging 0.99
IGL02230:Pipox APN 11 77881206 missense probably damaging 1.00
PIT4519001:Pipox UTSW 11 77883175 missense probably damaging 1.00
R0523:Pipox UTSW 11 77892139 missense probably damaging 1.00
R0666:Pipox UTSW 11 77883825 missense probably benign 0.20
R1375:Pipox UTSW 11 77881210 nonsense probably null
R1809:Pipox UTSW 11 77881534 missense probably benign 0.07
R1834:Pipox UTSW 11 77882123 missense probably damaging 1.00
R1897:Pipox UTSW 11 77882742 missense probably damaging 1.00
R2436:Pipox UTSW 11 77892117 missense probably damaging 1.00
R4674:Pipox UTSW 11 77893770 missense probably benign 0.02
R6480:Pipox UTSW 11 77882648 missense probably damaging 1.00
R6883:Pipox UTSW 11 77883903 missense probably benign 0.02
R6918:Pipox UTSW 11 77881554 missense probably damaging 0.99
R7223:Pipox UTSW 11 77881186 missense probably damaging 1.00
Z1177:Pipox UTSW 11 77881530 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCGCTGACTTTCTGGGAAGG -3'
(R):5'- TGACAGGTGGCAATTTCTGG -3'

Sequencing Primer
(F):5'- CTGACTTTCTGGGAAGGAGAAATG -3'
(R):5'- CAATTTCTGGCTTTGGGATGAGACC -3'
Posted On2018-06-22