Incidental Mutation 'R6586:Olfr107'
ID524442
Institutional Source Beutler Lab
Gene Symbol Olfr107
Ensembl Gene ENSMUSG00000063188
Gene Nameolfactory receptor 107
SynonymsMOR156-3, GA_x6K02T2PSCP-1867165-1868094
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6586 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37399226-37407477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37405905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 119 (R119H)
Ref Sequence ENSEMBL: ENSMUSP00000148879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077008] [ENSMUST00000215894] [ENSMUST00000215947] [ENSMUST00000215974] [ENSMUST00000216844]
Predicted Effect probably benign
Transcript: ENSMUST00000077008
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076267
Gene: ENSMUSG00000063188
AA Change: R119H

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.3e-5 PFAM
Pfam:7tm_1 38 287 3.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174238
Predicted Effect probably benign
Transcript: ENSMUST00000215894
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215947
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215974
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216844
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,328 F265L possibly damaging Het
9930022D16Rik A G 11: 109,417,960 T51A unknown Het
Acaa1a A G 9: 119,349,538 probably null Het
Clasp2 T C 9: 113,813,264 S280P probably damaging Het
Cnga3 T C 1: 37,261,278 S398P probably damaging Het
Cngb3 T G 4: 19,280,946 L5R probably damaging Het
Cyp2c65 T C 19: 39,082,218 F282L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnm2 T C 9: 21,505,646 F825S probably benign Het
Dusp27 T C 1: 166,100,885 E386G possibly damaging Het
Egfem1 T A 3: 29,662,411 C343* probably null Het
Fah T A 7: 84,593,260 D280V probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Flg A T 3: 93,292,983 probably benign Het
Flnb A G 14: 7,929,138 R1956G possibly damaging Het
Mterf2 A G 10: 85,120,106 F218S probably damaging Het
Nlrp1a A G 11: 71,106,073 V868A probably benign Het
Nrip2 T A 6: 128,404,948 C85* probably null Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr620 T A 7: 103,611,976 I126F possibly damaging Het
Palm A C 10: 79,809,531 N111H probably benign Het
Pipox T C 11: 77,881,179 D373G possibly damaging Het
Plec C T 15: 76,175,087 G3540D probably damaging Het
Psd3 T C 8: 67,963,545 T567A probably damaging Het
Psg28 T C 7: 18,430,544 Y81C probably damaging Het
Rarres1 A T 3: 67,491,033 N131K probably damaging Het
Rbbp8nl G A 2: 180,280,959 H214Y probably damaging Het
Tas2r135 A G 6: 42,406,018 T164A probably benign Het
Tmco3 G T 8: 13,320,894 probably benign Het
Tnpo2 T A 8: 85,045,202 M259K possibly damaging Het
Tns4 T C 11: 99,080,267 R206G probably benign Het
Trim60 G T 8: 65,000,596 L334I possibly damaging Het
Ttn T C 2: 76,730,410 T29216A probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn1r60 T A 7: 5,544,447 N218I probably benign Het
Vps25 T G 11: 101,259,009 V125G probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Ythdf2 A T 4: 132,205,600 M83K probably benign Het
Other mutations in Olfr107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Olfr107 APN 17 37406140 missense probably benign 0.00
IGL01614:Olfr107 APN 17 37405638 missense probably benign 0.00
IGL02390:Olfr107 APN 17 37406095 missense probably benign 0.04
R1051:Olfr107 UTSW 17 37406450 missense possibly damaging 0.74
R4767:Olfr107 UTSW 17 37406200 nonsense probably null
R4849:Olfr107 UTSW 17 37405698 missense probably benign 0.16
R6182:Olfr107 UTSW 17 37405992 missense possibly damaging 0.65
R6550:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6551:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6552:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6555:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6584:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6588:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6688:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6758:Olfr107 UTSW 17 37405695 missense probably damaging 0.97
R7024:Olfr107 UTSW 17 37406204 missense probably benign 0.04
R7083:Olfr107 UTSW 17 37406172 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTCAGCTCTCACTAGTGG -3'
(R):5'- TCACTGAGGTGAGTGTCTGAGC -3'

Sequencing Primer
(F):5'- AGTCAGCTCTCACTAGTGGATCTTTG -3'
(R):5'- CAGTAAGAGAGGCCTAGAATCAC -3'
Posted On2018-06-22