Incidental Mutation 'R6621:Slc10a7'
ID524443
Institutional Source Beutler Lab
Gene Symbol Slc10a7
Ensembl Gene ENSMUSG00000031684
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms2410193C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R6621 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location78509346-78734003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78515634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 50 (I50T)
Ref Sequence ENSEMBL: ENSMUSP00000147396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034111] [ENSMUST00000209490] [ENSMUST00000209992] [ENSMUST00000210515] [ENSMUST00000210630] [ENSMUST00000211286]
Predicted Effect probably damaging
Transcript: ENSMUST00000034111
AA Change: I50T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034111
Gene: ENSMUSG00000031684
AA Change: I50T

DomainStartEndE-ValueType
Pfam:SBF_like 10 324 1.9e-82 PFAM
Pfam:SBF 44 224 2.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209490
AA Change: I50T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000209992
AA Change: I50T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210515
Predicted Effect probably damaging
Transcript: ENSMUST00000210630
AA Change: I50T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211286
AA Change: I50T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,423 T30M possibly damaging Het
Abcb8 T C 5: 24,394,510 F8L probably benign Het
Akap13 G T 7: 75,569,981 C44F probably damaging Het
Ankrd34a A G 3: 96,598,215 N245S possibly damaging Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Chat C T 14: 32,419,013 A476T probably damaging Het
Cpsf1 T C 15: 76,603,519 D100G probably damaging Het
Cpt1a T A 19: 3,378,472 F615L probably damaging Het
Dpp4 T A 2: 62,352,140 D599V probably damaging Het
Dpysl5 T C 5: 30,784,469 probably null Het
Fam234a A G 17: 26,213,881 L460P probably damaging Het
Fsip2 T G 2: 82,989,814 V5297G possibly damaging Het
Gm28363 A G 1: 117,727,357 D102G probably benign Het
Greb1 A G 12: 16,692,717 V1377A probably damaging Het
Hat1 T A 2: 71,421,715 F264I probably benign Het
Kif3a A G 11: 53,579,130 I152M probably damaging Het
Lemd2 T C 17: 27,195,392 S323G probably benign Het
Manea T C 4: 26,340,363 probably null Het
Mcm9 T C 10: 53,563,313 E588G probably damaging Het
Mllt3 T G 4: 87,840,797 K338T possibly damaging Het
Nrxn1 T C 17: 90,162,182 T1324A probably damaging Het
Nudt8 T A 19: 4,001,320 Y64N probably benign Het
Olfr1137 A G 2: 87,711,555 V117A probably benign Het
Olfr1387 A G 11: 49,459,771 I31V probably benign Het
Olfr194 A T 16: 59,119,924 W49R probably benign Het
Olfr25 A T 9: 38,330,462 I289F probably damaging Het
Olfr60 A G 7: 140,345,455 F178S probably damaging Het
Olfr615 A G 7: 103,560,878 T134A possibly damaging Het
Osm T A 11: 4,239,541 D108E probably benign Het
Pde8a A G 7: 81,293,130 probably null Het
Phtf2 T C 5: 20,812,956 probably benign Het
Rnf214 T C 9: 45,896,170 D245G probably damaging Het
Slc5a6 A G 5: 31,040,778 V251A probably damaging Het
Sun3 T A 11: 9,016,242 T320S probably damaging Het
Zfp174 A G 16: 3,847,955 E28G probably damaging Het
Other mutations in Slc10a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Slc10a7 APN 8 78698580 splice site probably benign
IGL01589:Slc10a7 APN 8 78729740 missense probably damaging 0.98
IGL01868:Slc10a7 APN 8 78697336 splice site probably null
IGL02197:Slc10a7 APN 8 78515663 missense probably damaging 0.98
IGL02205:Slc10a7 APN 8 78697303 missense probably benign 0.04
IGL03128:Slc10a7 APN 8 78525217 missense probably damaging 1.00
R0123:Slc10a7 UTSW 8 78697158 splice site probably null
R0134:Slc10a7 UTSW 8 78697158 splice site probably null
R1973:Slc10a7 UTSW 8 78697333 critical splice donor site probably null
R2266:Slc10a7 UTSW 8 78509635 missense probably benign 0.02
R2362:Slc10a7 UTSW 8 78509632 missense probably damaging 0.99
R4756:Slc10a7 UTSW 8 78706950 critical splice donor site probably null
R5454:Slc10a7 UTSW 8 78686624 missense possibly damaging 0.71
R5753:Slc10a7 UTSW 8 78525299 critical splice donor site probably null
R7814:Slc10a7 UTSW 8 78698573 critical splice donor site probably null
R7977:Slc10a7 UTSW 8 78697214 missense probably benign 0.13
R7987:Slc10a7 UTSW 8 78697214 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTTGAGAGCTTCTCTGCAGTAG -3'
(R):5'- AGTGATGGTCCTGTCCCTATC -3'

Sequencing Primer
(F):5'- CTCTGCAGTAGGGAAGTATCTTAG -3'
(R):5'- ATCCATGTCATCCTTGTCAGTGGAG -3'
Posted On2018-06-22