Incidental Mutation 'R6586:Ythdc2'
ID524444
Institutional Source Beutler Lab
Gene Symbol Ythdc2
Ensembl Gene ENSMUSG00000034653
Gene NameYTH domain containing 2
Synonyms3010002F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6586 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location44827746-44889724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44845788 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 455 (D455G)
Ref Sequence ENSEMBL: ENSMUSP00000048340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037763]
Predicted Effect probably benign
Transcript: ENSMUST00000037763
AA Change: D455G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: D455G

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
Pfam:R3H 59 119 1.7e-15 PFAM
DEXDc 206 393 4.95e-26 SMART
low complexity region 413 428 N/A INTRINSIC
ANK 521 550 2.79e1 SMART
ANK 554 583 1.5e2 SMART
HELICc 648 759 5.31e-17 SMART
HA2 823 916 2.58e-22 SMART
Pfam:OB_NTP_bind 953 1082 1.3e-18 PFAM
low complexity region 1263 1299 N/A INTRINSIC
Pfam:YTH 1303 1434 7.2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,328 F265L possibly damaging Het
9930022D16Rik A G 11: 109,417,960 T51A unknown Het
Acaa1a A G 9: 119,349,538 probably null Het
Clasp2 T C 9: 113,813,264 S280P probably damaging Het
Cnga3 T C 1: 37,261,278 S398P probably damaging Het
Cngb3 T G 4: 19,280,946 L5R probably damaging Het
Cyp2c65 T C 19: 39,082,218 F282L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnm2 T C 9: 21,505,646 F825S probably benign Het
Dusp27 T C 1: 166,100,885 E386G possibly damaging Het
Egfem1 T A 3: 29,662,411 C343* probably null Het
Fah T A 7: 84,593,260 D280V probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Flg A T 3: 93,292,983 probably benign Het
Flnb A G 14: 7,929,138 R1956G possibly damaging Het
Mterf2 A G 10: 85,120,106 F218S probably damaging Het
Nlrp1a A G 11: 71,106,073 V868A probably benign Het
Nrip2 T A 6: 128,404,948 C85* probably null Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr620 T A 7: 103,611,976 I126F possibly damaging Het
Palm A C 10: 79,809,531 N111H probably benign Het
Pipox T C 11: 77,881,179 D373G possibly damaging Het
Plec C T 15: 76,175,087 G3540D probably damaging Het
Psd3 T C 8: 67,963,545 T567A probably damaging Het
Psg28 T C 7: 18,430,544 Y81C probably damaging Het
Rarres1 A T 3: 67,491,033 N131K probably damaging Het
Rbbp8nl G A 2: 180,280,959 H214Y probably damaging Het
Tas2r135 A G 6: 42,406,018 T164A probably benign Het
Tmco3 G T 8: 13,320,894 probably benign Het
Tnpo2 T A 8: 85,045,202 M259K possibly damaging Het
Tns4 T C 11: 99,080,267 R206G probably benign Het
Trim60 G T 8: 65,000,596 L334I possibly damaging Het
Ttn T C 2: 76,730,410 T29216A probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn1r60 T A 7: 5,544,447 N218I probably benign Het
Vps25 T G 11: 101,259,009 V125G probably damaging Het
Ythdf2 A T 4: 132,205,600 M83K probably benign Het
Other mutations in Ythdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ythdc2 APN 18 44859973 missense probably benign
IGL00341:Ythdc2 APN 18 44850397 missense probably benign 0.00
IGL00502:Ythdc2 APN 18 44847812 missense probably damaging 0.99
IGL00585:Ythdc2 APN 18 44864361 missense probably damaging 1.00
IGL01081:Ythdc2 APN 18 44850659 missense probably benign 0.19
IGL01569:Ythdc2 APN 18 44887651 missense probably benign
IGL01577:Ythdc2 APN 18 44858282 missense probably benign 0.00
IGL01617:Ythdc2 APN 18 44841415 missense possibly damaging 0.53
IGL01674:Ythdc2 APN 18 44860404 missense probably benign 0.04
IGL01736:Ythdc2 APN 18 44850668 missense probably damaging 0.97
IGL02095:Ythdc2 APN 18 44873140 splice site probably benign
IGL02245:Ythdc2 APN 18 44862684 missense possibly damaging 0.74
IGL02524:Ythdc2 APN 18 44847854 missense probably damaging 0.98
IGL02542:Ythdc2 APN 18 44840241 missense probably damaging 1.00
IGL02622:Ythdc2 APN 18 44859934 missense probably damaging 0.99
IGL02795:Ythdc2 APN 18 44837438 missense possibly damaging 0.95
IGL02935:Ythdc2 APN 18 44855045 missense probably damaging 1.00
PIT4618001:Ythdc2 UTSW 18 44834598 missense probably benign 0.19
R0115:Ythdc2 UTSW 18 44841423 splice site probably benign
R0329:Ythdc2 UTSW 18 44865060 splice site probably benign
R0472:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R0530:Ythdc2 UTSW 18 44850398 missense probably damaging 0.99
R0547:Ythdc2 UTSW 18 44840264 missense possibly damaging 0.92
R0563:Ythdc2 UTSW 18 44864848 splice site probably benign
R0609:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R1291:Ythdc2 UTSW 18 44855209 missense probably benign 0.33
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1724:Ythdc2 UTSW 18 44828690 missense probably benign 0.04
R1860:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R2040:Ythdc2 UTSW 18 44855174 nonsense probably null
R2308:Ythdc2 UTSW 18 44847748 missense possibly damaging 0.95
R3711:Ythdc2 UTSW 18 44833173 missense probably damaging 0.98
R4005:Ythdc2 UTSW 18 44833128 missense probably benign 0.00
R4580:Ythdc2 UTSW 18 44858198 missense possibly damaging 0.81
R4631:Ythdc2 UTSW 18 44887631 missense probably benign 0.03
R4815:Ythdc2 UTSW 18 44885240 missense probably benign 0.40
R4924:Ythdc2 UTSW 18 44847804 missense probably damaging 1.00
R4982:Ythdc2 UTSW 18 44871465 missense probably benign 0.01
R5011:Ythdc2 UTSW 18 44854742 missense probably benign 0.38
R5141:Ythdc2 UTSW 18 44865047 missense probably benign 0.01
R5147:Ythdc2 UTSW 18 44844292 missense probably damaging 0.98
R5280:Ythdc2 UTSW 18 44860621 missense probably damaging 1.00
R5388:Ythdc2 UTSW 18 44857025 missense possibly damaging 0.65
R5928:Ythdc2 UTSW 18 44833205 missense probably benign
R5931:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R5995:Ythdc2 UTSW 18 44886253 missense probably damaging 1.00
R6027:Ythdc2 UTSW 18 44860436 missense probably benign 0.02
R6056:Ythdc2 UTSW 18 44840210 missense probably damaging 0.98
R6318:Ythdc2 UTSW 18 44860377 missense probably benign 0.04
R6399:Ythdc2 UTSW 18 44886402 missense possibly damaging 0.93
R6684:Ythdc2 UTSW 18 44873069 missense possibly damaging 0.47
R7040:Ythdc2 UTSW 18 44834462 missense probably benign 0.02
R7071:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R7105:Ythdc2 UTSW 18 44834563 missense probably damaging 1.00
R7148:Ythdc2 UTSW 18 44833122 missense probably benign 0.42
R7290:Ythdc2 UTSW 18 44837491 missense possibly damaging 0.50
R7806:Ythdc2 UTSW 18 44844286 missense possibly damaging 0.91
R7806:Ythdc2 UTSW 18 44850424 missense probably benign 0.05
R8114:Ythdc2 UTSW 18 44877740 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGTTTAAGCAAAGGAACAGGTTATC -3'
(R):5'- AGGCCCTAGATTTCATCTCCAAC -3'

Sequencing Primer
(F):5'- TTATCAGAAGGAAAGGACCAAGTAC -3'
(R):5'- CCTCATAAAAGTTGTTTAGCCT -3'
Posted On2018-06-22