Incidental Mutation 'R6586:Cyp2c65'
ID524446
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6586 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39061015-39093944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39082218 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 282 (F282L)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087236
AA Change: F282L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: F282L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,328 F265L possibly damaging Het
9930022D16Rik A G 11: 109,417,960 T51A unknown Het
Acaa1a A G 9: 119,349,538 probably null Het
Clasp2 T C 9: 113,813,264 S280P probably damaging Het
Cnga3 T C 1: 37,261,278 S398P probably damaging Het
Cngb3 T G 4: 19,280,946 L5R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnm2 T C 9: 21,505,646 F825S probably benign Het
Dusp27 T C 1: 166,100,885 E386G possibly damaging Het
Egfem1 T A 3: 29,662,411 C343* probably null Het
Fah T A 7: 84,593,260 D280V probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Flg A T 3: 93,292,983 probably benign Het
Flnb A G 14: 7,929,138 R1956G possibly damaging Het
Mterf2 A G 10: 85,120,106 F218S probably damaging Het
Nlrp1a A G 11: 71,106,073 V868A probably benign Het
Nrip2 T A 6: 128,404,948 C85* probably null Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr620 T A 7: 103,611,976 I126F possibly damaging Het
Palm A C 10: 79,809,531 N111H probably benign Het
Pipox T C 11: 77,881,179 D373G possibly damaging Het
Plec C T 15: 76,175,087 G3540D probably damaging Het
Psd3 T C 8: 67,963,545 T567A probably damaging Het
Psg28 T C 7: 18,430,544 Y81C probably damaging Het
Rarres1 A T 3: 67,491,033 N131K probably damaging Het
Rbbp8nl G A 2: 180,280,959 H214Y probably damaging Het
Tas2r135 A G 6: 42,406,018 T164A probably benign Het
Tmco3 G T 8: 13,320,894 probably benign Het
Tnpo2 T A 8: 85,045,202 M259K possibly damaging Het
Tns4 T C 11: 99,080,267 R206G probably benign Het
Trim60 G T 8: 65,000,596 L334I possibly damaging Het
Ttn T C 2: 76,730,410 T29216A probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn1r60 T A 7: 5,544,447 N218I probably benign Het
Vps25 T G 11: 101,259,009 V125G probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Ythdf2 A T 4: 132,205,600 M83K probably benign Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4208:Cyp2c65 UTSW 19 39090655 missense probably damaging 1.00
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5060:Cyp2c65 UTSW 19 39061070 missense unknown
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6400:Cyp2c65 UTSW 19 39061114 missense possibly damaging 0.80
R6672:Cyp2c65 UTSW 19 39087674 missense probably damaging 1.00
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
R8075:Cyp2c65 UTSW 19 39072238 missense probably benign 0.10
R8756:Cyp2c65 UTSW 19 39061108 nonsense probably null
R9006:Cyp2c65 UTSW 19 39082270 missense probably damaging 1.00
R9031:Cyp2c65 UTSW 19 39073219 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGTCTACATATCTCCTGAACAC -3'
(R):5'- CAGATTGTAGTGCCACAAAAGG -3'

Sequencing Primer
(F):5'- TGAACACAGGCCAGTTTCTTC -3'
(R):5'- TCTGAGGTTTCCCTTAGACAAAC -3'
Posted On2018-06-22