Incidental Mutation 'R6621:Olfr25'
ID524447
Institutional Source Beutler Lab
Gene Symbol Olfr25
Ensembl Gene ENSMUSG00000058270
Gene Nameolfactory receptor 25
SynonymsGA_x6K02T2PVTD-32017922-32018863, MOR170-4, MTPCR18
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6621 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38329060-38335889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38330462 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 289 (I289F)
Ref Sequence ENSEMBL: ENSMUSP00000150567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071449] [ENSMUST00000212354] [ENSMUST00000214155]
Predicted Effect probably damaging
Transcript: ENSMUST00000071449
AA Change: I292F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071393
Gene: ENSMUSG00000058270
AA Change: I292F

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 3.1e-46 PFAM
Pfam:7tm_1 44 243 8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212354
AA Change: I289F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214155
AA Change: I289F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,423 T30M possibly damaging Het
Abcb8 T C 5: 24,394,510 F8L probably benign Het
Akap13 G T 7: 75,569,981 C44F probably damaging Het
Ankrd34a A G 3: 96,598,215 N245S possibly damaging Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Chat C T 14: 32,419,013 A476T probably damaging Het
Cpsf1 T C 15: 76,603,519 D100G probably damaging Het
Cpt1a T A 19: 3,378,472 F615L probably damaging Het
Dpp4 T A 2: 62,352,140 D599V probably damaging Het
Dpysl5 T C 5: 30,784,469 probably null Het
Fam234a A G 17: 26,213,881 L460P probably damaging Het
Fsip2 T G 2: 82,989,814 V5297G possibly damaging Het
Gm28363 A G 1: 117,727,357 D102G probably benign Het
Greb1 A G 12: 16,692,717 V1377A probably damaging Het
Hat1 T A 2: 71,421,715 F264I probably benign Het
Kif3a A G 11: 53,579,130 I152M probably damaging Het
Lemd2 T C 17: 27,195,392 S323G probably benign Het
Manea T C 4: 26,340,363 probably null Het
Mcm9 T C 10: 53,563,313 E588G probably damaging Het
Mllt3 T G 4: 87,840,797 K338T possibly damaging Het
Nrxn1 T C 17: 90,162,182 T1324A probably damaging Het
Nudt8 T A 19: 4,001,320 Y64N probably benign Het
Olfr1137 A G 2: 87,711,555 V117A probably benign Het
Olfr1387 A G 11: 49,459,771 I31V probably benign Het
Olfr194 A T 16: 59,119,924 W49R probably benign Het
Olfr60 A G 7: 140,345,455 F178S probably damaging Het
Olfr615 A G 7: 103,560,878 T134A possibly damaging Het
Osm T A 11: 4,239,541 D108E probably benign Het
Pde8a A G 7: 81,293,130 probably null Het
Phtf2 T C 5: 20,812,956 probably benign Het
Rnf214 T C 9: 45,896,170 D245G probably damaging Het
Slc10a7 T C 8: 78,515,634 I50T probably damaging Het
Slc5a6 A G 5: 31,040,778 V251A probably damaging Het
Sun3 T A 11: 9,016,242 T320S probably damaging Het
Zfp174 A G 16: 3,847,955 E28G probably damaging Het
Other mutations in Olfr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Olfr25 APN 9 38329703 missense probably benign 0.01
IGL02044:Olfr25 APN 9 38330165 missense probably benign 0.16
IGL02698:Olfr25 APN 9 38330210 missense probably benign 0.03
IGL03084:Olfr25 APN 9 38330217 missense probably damaging 0.97
IGL03355:Olfr25 APN 9 38329656 missense probably benign 0.05
R0453:Olfr25 UTSW 9 38330171 missense probably benign 0.36
R1584:Olfr25 UTSW 9 38330131 missense possibly damaging 0.90
R1707:Olfr25 UTSW 9 38329901 missense probably damaging 0.99
R1719:Olfr25 UTSW 9 38330507 missense probably benign 0.23
R3409:Olfr25 UTSW 9 38330344 missense possibly damaging 0.94
R4810:Olfr25 UTSW 9 38330394 missense probably benign 0.00
R6271:Olfr25 UTSW 9 38330282 missense probably benign 0.09
R7220:Olfr25 UTSW 9 38329750 missense probably damaging 1.00
R7562:Olfr25 UTSW 9 38329943 missense probably damaging 1.00
X0019:Olfr25 UTSW 9 38329959 missense probably damaging 1.00
X0027:Olfr25 UTSW 9 38329802 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTGTGGTGGGTACAGCTATC -3'
(R):5'- GAAACAAGACAGTATTGTAGGACTC -3'

Sequencing Primer
(F):5'- ATCGTTCATATGTCATCAGGTAAGGG -3'
(R):5'- GAAATGAAAGCAAACCAGCT -3'
Posted On2018-06-22