Incidental Mutation 'R6621:Rnf214'
ID524449
Institutional Source Beutler Lab
Gene Symbol Rnf214
Ensembl Gene ENSMUSG00000042790
Gene Namering finger protein 214
SynonymsD130054N24Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178709.4; MGI:2444451

Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R6621 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45863425-45906911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45896170 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 245 (D245G)
Ref Sequence ENSEMBL: ENSMUSP00000149889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058720] [ENSMUST00000160699] [ENSMUST00000160811] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699] [ENSMUST00000213659]
Predicted Effect probably damaging
Transcript: ENSMUST00000058720
AA Change: D245G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790
AA Change: D245G

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160469
Predicted Effect probably damaging
Transcript: ENSMUST00000160699
AA Change: D245G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790
AA Change: D245G

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160811
Predicted Effect probably damaging
Transcript: ENSMUST00000161187
AA Change: D90G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790
AA Change: D90G

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161203
AA Change: D90G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790
AA Change: D90G

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162369
AA Change: D245G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Predicted Effect probably benign
Transcript: ENSMUST00000213659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215005
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 100% (36/36)
Allele List at MGI

All alleles(12) : Targeted(3) Gene trapped(9)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,423 T30M possibly damaging Het
Abcb8 T C 5: 24,394,510 F8L probably benign Het
Akap13 G T 7: 75,569,981 C44F probably damaging Het
Ankrd34a A G 3: 96,598,215 N245S possibly damaging Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Chat C T 14: 32,419,013 A476T probably damaging Het
Cpsf1 T C 15: 76,603,519 D100G probably damaging Het
Cpt1a T A 19: 3,378,472 F615L probably damaging Het
Dpp4 T A 2: 62,352,140 D599V probably damaging Het
Dpysl5 T C 5: 30,784,469 probably null Het
Fam234a A G 17: 26,213,881 L460P probably damaging Het
Fsip2 T G 2: 82,989,814 V5297G possibly damaging Het
Gm28363 A G 1: 117,727,357 D102G probably benign Het
Greb1 A G 12: 16,692,717 V1377A probably damaging Het
Hat1 T A 2: 71,421,715 F264I probably benign Het
Kif3a A G 11: 53,579,130 I152M probably damaging Het
Lemd2 T C 17: 27,195,392 S323G probably benign Het
Manea T C 4: 26,340,363 probably null Het
Mcm9 T C 10: 53,563,313 E588G probably damaging Het
Mllt3 T G 4: 87,840,797 K338T possibly damaging Het
Nrxn1 T C 17: 90,162,182 T1324A probably damaging Het
Nudt8 T A 19: 4,001,320 Y64N probably benign Het
Olfr1137 A G 2: 87,711,555 V117A probably benign Het
Olfr1387 A G 11: 49,459,771 I31V probably benign Het
Olfr194 A T 16: 59,119,924 W49R probably benign Het
Olfr25 A T 9: 38,330,462 I289F probably damaging Het
Olfr60 A G 7: 140,345,455 F178S probably damaging Het
Olfr615 A G 7: 103,560,878 T134A possibly damaging Het
Osm T A 11: 4,239,541 D108E probably benign Het
Pde8a A G 7: 81,293,130 probably null Het
Phtf2 T C 5: 20,812,956 probably benign Het
Slc10a7 T C 8: 78,515,634 I50T probably damaging Het
Slc5a6 A G 5: 31,040,778 V251A probably damaging Het
Sun3 T A 11: 9,016,242 T320S probably damaging Het
Zfp174 A G 16: 3,847,955 E28G probably damaging Het
Other mutations in Rnf214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Rnf214 APN 9 45899786 missense probably damaging 1.00
IGL02314:Rnf214 APN 9 45899807 missense probably benign 0.00
IGL02604:Rnf214 APN 9 45869543 missense probably damaging 1.00
IGL02739:Rnf214 APN 9 45869474 missense probably benign
Contorted UTSW 9 45868046 nonsense probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0091:Rnf214 UTSW 9 45898493 critical splice acceptor site probably null
R0375:Rnf214 UTSW 9 45899823 missense probably damaging 0.97
R1027:Rnf214 UTSW 9 45899889 missense probably benign
R1850:Rnf214 UTSW 9 45869448 splice site probably benign
R2424:Rnf214 UTSW 9 45899798 missense probably damaging 0.99
R3751:Rnf214 UTSW 9 45867603 missense probably damaging 1.00
R3772:Rnf214 UTSW 9 45866634 missense possibly damaging 0.83
R4164:Rnf214 UTSW 9 45871912 missense probably damaging 0.99
R4969:Rnf214 UTSW 9 45896188 missense probably damaging 1.00
R5032:Rnf214 UTSW 9 45899744 critical splice donor site probably null
R5647:Rnf214 UTSW 9 45868046 nonsense probably null
R5849:Rnf214 UTSW 9 45868088 missense probably damaging 1.00
R5894:Rnf214 UTSW 9 45866618 missense probably damaging 1.00
R6296:Rnf214 UTSW 9 45867821 missense probably benign 0.05
R6467:Rnf214 UTSW 9 45867588 missense probably damaging 0.97
R6533:Rnf214 UTSW 9 45900063 missense probably benign 0.00
R6801:Rnf214 UTSW 9 45896105 missense probably damaging 1.00
R6940:Rnf214 UTSW 9 45890898 missense probably damaging 0.99
R7398:Rnf214 UTSW 9 45867547 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACACAATACTTATCTGAGTTGCCA -3'
(R):5'- CAAATGCTTGTGCGTGCTTCAG -3'

Sequencing Primer
(F):5'- TTTTGTGGTTCTGGGAATCGAACC -3'
(R):5'- GGTTGATAGAACACTTGCCATCGC -3'
Posted On2018-06-22