Incidental Mutation 'R6587:Cfhr2'
ID524451
Institutional Source Beutler Lab
Gene Symbol Cfhr2
Ensembl Gene ENSMUSG00000033898
Gene Namecomplement factor H-related 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6587 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location139804167-139858702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139810858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 322 (I322F)
Ref Sequence ENSEMBL: ENSMUSP00000092065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094489] [ENSMUST00000194186]
Predicted Effect probably benign
Transcript: ENSMUST00000094489
AA Change: I322F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092065
Gene: ENSMUSG00000033898
AA Change: I322F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
CCP 270 331 1.16e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194186
SMART Domains Protein: ENSMUSP00000142033
Gene: ENSMUSG00000033898

DomainStartEndE-ValueType
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Camkmt T C 17: 85,113,815 V115A possibly damaging Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Krt78 T C 15: 101,952,269 K201R probably benign Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem260 A G 14: 48,496,456 probably null Het
Tmem8 G A 17: 26,121,564 V641I probably benign Het
Tmprss15 T G 16: 79,071,429 L198F probably benign Het
Tulp4 C T 17: 6,231,871 T725I possibly damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Cfhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cfhr2 APN 1 139831232 missense probably benign 0.09
IGL01721:Cfhr2 APN 1 139813614 missense probably benign 0.00
IGL02160:Cfhr2 APN 1 139810926 missense probably benign
IGL02189:Cfhr2 APN 1 139821759 missense probably damaging 0.98
IGL02802:Cfhr2 APN 1 139811024 intron probably benign
PIT4677001:Cfhr2 UTSW 1 139805379 missense unknown
R0470:Cfhr2 UTSW 1 139821779 missense probably damaging 1.00
R0586:Cfhr2 UTSW 1 139813434 nonsense probably null
R1401:Cfhr2 UTSW 1 139811019 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1729:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1729:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1730:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1730:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1739:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1739:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1762:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1762:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1779:Cfhr2 UTSW 1 139858645 utr 5 prime probably null
R1783:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1783:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1784:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1784:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1785:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1785:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R2130:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2131:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2141:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2142:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R4626:Cfhr2 UTSW 1 139813576 missense probably damaging 1.00
R4938:Cfhr2 UTSW 1 139813527 missense probably benign 0.02
R5225:Cfhr2 UTSW 1 139821782 missense possibly damaging 0.69
R5578:Cfhr2 UTSW 1 139831068 nonsense probably null
R6144:Cfhr2 UTSW 1 139805415 unclassified probably benign
R6312:Cfhr2 UTSW 1 139831079 missense possibly damaging 0.47
R6370:Cfhr2 UTSW 1 139822327 missense probably damaging 1.00
R7028:Cfhr2 UTSW 1 139831063 critical splice donor site probably null
R7051:Cfhr2 UTSW 1 139810978 missense probably benign 0.00
R7162:Cfhr2 UTSW 1 139813526 missense probably benign 0.08
R7166:Cfhr2 UTSW 1 139831101 nonsense probably null
R7503:Cfhr2 UTSW 1 139831214 missense probably damaging 0.99
R7752:Cfhr2 UTSW 1 139813584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAATTCTGAGAAAGTTCTG -3'
(R):5'- ACCCAAATTGGTCTATAGATATGGG -3'

Sequencing Primer
(F):5'- ACAGATGTTGAAGAACTTACATCTAC -3'
(R):5'- AATTTGGTAATTTTTCCTTCAGATGC -3'
Posted On2018-06-22