Incidental Mutation 'R6587:Tmem260'
ID 524465
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6587 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation splice site (80 bp from exon)
DNA Base Change (assembly) A to G at 48496456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226422] [ENSMUST00000227440] [ENSMUST00000228697]
AlphaFold Q8BMD6
Predicted Effect probably damaging
Transcript: ENSMUST00000111735
AA Change: D460G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: D460G

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124720
AA Change: D308G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339
AA Change: D308G

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133744
Predicted Effect probably benign
Transcript: ENSMUST00000153765
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156480
Predicted Effect probably damaging
Transcript: ENSMUST00000226422
AA Change: D460G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227440
AA Change: D460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000228697
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Camkmt T C 17: 85,113,815 V115A possibly damaging Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Cfhr2 T A 1: 139,810,858 I322F probably benign Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Krt78 T C 15: 101,952,269 K201R probably benign Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem8 G A 17: 26,121,564 V641I probably benign Het
Tmprss15 T G 16: 79,071,429 L198F probably benign Het
Tulp4 C T 17: 6,231,871 T725I possibly damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R8795:Tmem260 UTSW 14 48451913 missense probably damaging 1.00
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9056:Tmem260 UTSW 14 48480317 missense probably benign
R9096:Tmem260 UTSW 14 48520346 missense unknown
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGTACACATATGGAGGGAGA -3'
(R):5'- TTCCTTTCTCCACAGAAACCCA -3'

Sequencing Primer
(F):5'- TACACATATGGAGGGAGAGGAAAAC -3'
(R):5'- GAAACCCACAGAAAAGAATGATTATG -3'
Posted On 2018-06-22