Incidental Mutation 'R6587:Tmprss15'
ID524473
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6587 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79071429 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 198 (L198F)
Ref Sequence ENSEMBL: ENSMUSP00000052034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably benign
Transcript: ENSMUST00000023566
AA Change: L198F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: L198F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
AA Change: L198F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: L198F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Camkmt T C 17: 85,113,815 V115A possibly damaging Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Cfhr2 T A 1: 139,810,858 I322F probably benign Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Krt78 T C 15: 101,952,269 K201R probably benign Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem260 A G 14: 48,496,456 probably null Het
Tmem8 G A 17: 26,121,564 V641I probably benign Het
Tulp4 C T 17: 6,231,871 T725I possibly damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 79071288 missense probably benign
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTTGCATAATTTTGGCAATCAG -3'
(R):5'- GGCGACCTAAGTTCAGGATTAG -3'

Sequencing Primer
(F):5'- AGAACTGACCTGAAGTTGTTGC -3'
(R):5'- TCACACTGCAGCAATGAC -3'
Posted On2018-06-22