Incidental Mutation 'R6587:Tulp4'
ID524475
Institutional Source Beutler Lab
Gene Symbol Tulp4
Ensembl Gene ENSMUSG00000034377
Gene Nametubby like protein 4
Synonyms2210038L17Rik, 1110057P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R6587 (G1)
Quality Score105.008
Status Not validated
Chromosome17
Chromosomal Location6106437-6251128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6231871 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 725 (T725I)
Ref Sequence ENSEMBL: ENSMUSP00000049248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039655] [ENSMUST00000149756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039655
AA Change: T725I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049248
Gene: ENSMUSG00000034377
AA Change: T725I

DomainStartEndE-ValueType
WD40 71 110 2.49e-1 SMART
Blast:WD40 113 153 9e-21 BLAST
WD40 159 195 1.84e1 SMART
low complexity region 226 238 N/A INTRINSIC
Blast:WD40 275 306 8e-8 BLAST
Blast:WD40 330 371 1e-14 BLAST
SOCS_box 374 411 2.31e-1 SMART
SCOP:d1c8za_ 418 505 1e-18 SMART
low complexity region 509 518 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
SCOP:d1c8za_ 594 669 8e-12 SMART
low complexity region 770 789 N/A INTRINSIC
low complexity region 837 864 N/A INTRINSIC
low complexity region 1021 1026 N/A INTRINSIC
low complexity region 1041 1056 N/A INTRINSIC
low complexity region 1174 1181 N/A INTRINSIC
low complexity region 1188 1197 N/A INTRINSIC
Pfam:Tub 1346 1543 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137063
SMART Domains Protein: ENSMUSP00000123119
Gene: ENSMUSG00000034377

DomainStartEndE-ValueType
low complexity region 37 42 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
low complexity region 190 197 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
Pfam:Tub 345 537 3.3e-11 PFAM
low complexity region 603 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149756
AA Change: T532I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123218
Gene: ENSMUSG00000034377
AA Change: T532I

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:WD40 82 113 6e-8 BLAST
Blast:WD40 137 178 1e-14 BLAST
SOCS_box 181 218 2.31e-1 SMART
SCOP:d1c8za_ 225 312 2e-18 SMART
low complexity region 316 325 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
SCOP:d1c8za_ 401 476 9e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 644 671 N/A INTRINSIC
low complexity region 828 833 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 981 988 N/A INTRINSIC
low complexity region 995 1004 N/A INTRINSIC
coiled coil region 1187 1215 N/A INTRINSIC
Pfam:Tub 1224 1350 5.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Camkmt T C 17: 85,113,815 V115A possibly damaging Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Cfhr2 T A 1: 139,810,858 I322F probably benign Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Krt78 T C 15: 101,952,269 K201R probably benign Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem260 A G 14: 48,496,456 probably null Het
Tmem8 G A 17: 26,121,564 V641I probably benign Het
Tmprss15 T G 16: 79,071,429 L198F probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Tulp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Tulp4 APN 17 6139076 missense probably damaging 0.97
IGL02503:Tulp4 APN 17 6213391 missense probably damaging 0.99
IGL03012:Tulp4 APN 17 6213379 splice site probably benign
IGL03219:Tulp4 APN 17 6139010 missense probably damaging 1.00
tuba_mirum UTSW 17 6201819 missense probably damaging 1.00
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0711:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R1718:Tulp4 UTSW 17 6222440 missense probably benign 0.39
R1736:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R1775:Tulp4 UTSW 17 6139046 missense probably damaging 0.96
R1793:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R3160:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3162:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3431:Tulp4 UTSW 17 6206964 missense probably benign 0.03
R4081:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4082:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4610:Tulp4 UTSW 17 6198833 missense probably damaging 0.96
R4963:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R4966:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R5386:Tulp4 UTSW 17 6236293 missense probably damaging 1.00
R6019:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R6275:Tulp4 UTSW 17 6198736 missense probably damaging 1.00
R6294:Tulp4 UTSW 17 6201819 missense probably damaging 1.00
R6680:Tulp4 UTSW 17 6139037 missense probably damaging 1.00
R7030:Tulp4 UTSW 17 6214666 missense probably damaging 1.00
R7068:Tulp4 UTSW 17 6185289 missense probably damaging 1.00
R7109:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7110:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7229:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7230:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7231:Tulp4 UTSW 17 6236235 missense probably benign 0.03
R7438:Tulp4 UTSW 17 6198708 missense probably benign 0.42
R7750:Tulp4 UTSW 17 6233124 missense probably damaging 1.00
X0067:Tulp4 UTSW 17 6206923 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGTATGTGTCTTATTCTGGCATAG -3'
(R):5'- TTCTGCAGGTGCTCATGGTC -3'

Sequencing Primer
(F):5'- AGTTCTATTACACTGTTTTGCAACCG -3'
(R):5'- ATGGTCCCGATCTCCATGG -3'
Posted On2018-06-22