Incidental Mutation 'R6587:Tmem8'
ID524478
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6587 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26121564 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 641 (V641I)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably benign
Transcript: ENSMUST00000025010
AA Change: V641I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: V641I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG 2: 25,272,538 probably benign Het
Ank3 G T 10: 69,990,152 probably benign Het
Ano3 C A 2: 110,797,904 probably null Het
Arhgap39 A G 15: 76,737,499 S301P probably damaging Het
Atad2 G T 15: 58,121,048 Q295K probably benign Het
Camkmt T C 17: 85,113,815 V115A possibly damaging Het
Cenpf T C 1: 189,658,374 E1087G probably damaging Het
Cfhr2 T A 1: 139,810,858 I322F probably benign Het
Chil6 T C 3: 106,404,881 M35V probably benign Het
Cyp3a44 T C 5: 145,805,759 T11A probably benign Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Ghitm A T 14: 37,125,189 Y309* probably null Het
Klhl18 T C 9: 110,455,426 H64R probably damaging Het
Krt78 T C 15: 101,952,269 K201R probably benign Het
Lpar3 T C 3: 146,241,163 F199L probably damaging Het
Mindy3 G A 2: 12,348,116 Q425* probably null Het
Olfr1468-ps1 A T 19: 13,375,613 Y217F unknown Het
P2rx7 A C 5: 122,664,550 N207T probably damaging Het
Pcdhb7 T G 18: 37,344,103 L764R probably benign Het
Sbf2 T C 7: 110,440,975 Y378C probably damaging Het
Slc23a2 C T 2: 132,078,481 S168N possibly damaging Het
Tmem260 A G 14: 48,496,456 probably null Het
Tmprss15 T G 16: 79,071,429 L198F probably benign Het
Tulp4 C T 17: 6,231,871 T725I possibly damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zcchc11 C A 4: 108,479,449 N123K probably benign Het
Zp3 A G 5: 135,987,498 D318G possibly damaging Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 unclassified probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGAGTCTTAAGAGGAGCCG -3'
(R):5'- CTGCTACCGACTCTAAACAGATG -3'

Sequencing Primer
(F):5'- TCTTAAGAGGAGCCGACAGAG -3'
(R):5'- CTACCGACTCTAAACAGATGTGGAG -3'
Posted On2018-06-22