Incidental Mutation 'R6622:Cnppd1'
ID 524485
Institutional Source Beutler Lab
Gene Symbol Cnppd1
Ensembl Gene ENSMUSG00000033159
Gene Name cyclin Pas1/PHO80 domain containing 1
Synonyms 1810031K17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6622 (G1)
Quality Score 189.009
Status Not validated
Chromosome 1
Chromosomal Location 75112406-75119374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75113539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 243 (V243E)
Ref Sequence ENSEMBL: ENSMUSP00000140289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027405] [ENSMUST00000041213] [ENSMUST00000168720] [ENSMUST00000190679] [ENSMUST00000189403] [ENSMUST00000189809]
AlphaFold Q8K158
Predicted Effect probably benign
Transcript: ENSMUST00000027405
SMART Domains Protein: ENSMUSP00000027405
Gene: ENSMUSG00000026205

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
Pfam:Xan_ur_permease 50 122 4.6e-12 PFAM
Pfam:Xan_ur_permease 115 476 2.3e-100 PFAM
transmembrane domain 490 512 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041213
AA Change: V243E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044799
Gene: ENSMUSG00000033159
AA Change: V243E

DomainStartEndE-ValueType
Pfam:Cyclin 72 174 7.5e-10 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168720
AA Change: V243E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132688
Gene: ENSMUSG00000033159
AA Change: V243E

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188080
Predicted Effect probably damaging
Transcript: ENSMUST00000190679
AA Change: V243E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140289
Gene: ENSMUSG00000033159
AA Change: V243E

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189403
SMART Domains Protein: ENSMUSP00000141062
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 44 170 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189809
SMART Domains Protein: ENSMUSP00000140262
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Blast:CYCLIN 81 114 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189043
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Cnppd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Cnppd1 APN 1 75,116,236 (GRCm39) splice site probably null
R0279:Cnppd1 UTSW 1 75,113,573 (GRCm39) missense probably damaging 0.97
R4843:Cnppd1 UTSW 1 75,113,086 (GRCm39) missense probably benign
R5860:Cnppd1 UTSW 1 75,113,131 (GRCm39) missense probably benign
R7301:Cnppd1 UTSW 1 75,113,068 (GRCm39) missense probably damaging 1.00
R8852:Cnppd1 UTSW 1 75,113,063 (GRCm39) missense probably damaging 1.00
R8860:Cnppd1 UTSW 1 75,113,063 (GRCm39) missense probably damaging 1.00
R8967:Cnppd1 UTSW 1 75,113,265 (GRCm39) nonsense probably null
R9231:Cnppd1 UTSW 1 75,116,261 (GRCm39) missense possibly damaging 0.46
R9367:Cnppd1 UTSW 1 75,117,617 (GRCm39) missense probably benign 0.00
Z1176:Cnppd1 UTSW 1 75,117,595 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAAAGGGGACATTTGTG -3'
(R):5'- TCTCAGAAGAAGTTGAGACTAGATG -3'

Sequencing Primer
(F):5'- TGATGGCAAGTCTACACTGC -3'
(R):5'- TTGAGACTAGATGGGAGGGTG -3'
Posted On 2018-06-22