Incidental Mutation 'R6589:Gm5415'
ID524486
Institutional Source Beutler Lab
Gene Symbol Gm5415
Ensembl Gene ENSMUSG00000091318
Gene Namepredicted gene 5415
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6589 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location32543686-32547294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32546711 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 39 (D39E)
Ref Sequence ENSEMBL: ENSMUSP00000132789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000171322]
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171322
AA Change: D39E

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132789
Gene: ENSMUSG00000091318
AA Change: D39E

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
Pfam:Peptidase_C48 298 477 7.4e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195761
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 G A 13: 112,348,863 probably null Het
Asic2 G T 11: 80,886,604 A427D possibly damaging Het
B3gnt2 T A 11: 22,837,117 I24F probably damaging Het
BC030500 T C 8: 58,912,922 probably benign Het
Cdh4 G A 2: 179,881,996 probably null Het
Cramp1l T C 17: 24,977,492 probably null Het
Fam19a2 T A 10: 123,704,392 V51E probably damaging Het
Fam72a A T 1: 131,533,816 I80F probably damaging Het
Fbxo43 T C 15: 36,162,540 T174A probably damaging Het
Fgf11 C A 11: 69,799,435 V109L probably damaging Het
Fggy A G 4: 95,597,638 I74V probably benign Het
Fshr T C 17: 88,988,607 D224G probably damaging Het
Gm6465 A G 5: 11,848,161 T81A possibly damaging Het
Gm9268 T A 7: 43,023,598 S142T possibly damaging Het
Hdac9 T C 12: 34,215,029 E908G probably damaging Het
Hspa4l T G 3: 40,757,055 L121V probably damaging Het
Klk1b16 A G 7: 44,141,470 D232G probably benign Het
Lpl G T 8: 68,896,807 M328I probably benign Het
Mgat4a T C 1: 37,444,895 E498G probably damaging Het
Mup11 T A 4: 60,659,541 Q91L possibly damaging Het
Myoc T A 1: 162,648,619 Y297* probably null Het
Olfr126 T A 17: 37,850,836 Y81* probably null Het
Siva1 A G 12: 112,646,838 E40G probably damaging Het
Smarca2 T A 19: 26,619,884 H55Q possibly damaging Het
Taf1b A G 12: 24,556,528 E449G possibly damaging Het
Tcaf3 A T 6: 42,594,061 N252K possibly damaging Het
Trim3 A G 7: 105,617,960 L404P probably damaging Het
Vmn2r114 T C 17: 23,291,668 T613A probably damaging Het
Zfp358 T A 8: 3,495,907 F163Y probably damaging Het
Other mutations in Gm5415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Gm5415 APN 1 32546667 missense probably benign
IGL01148:Gm5415 APN 1 32545654 missense possibly damaging 0.88
IGL02323:Gm5415 APN 1 32545704 nonsense probably null
IGL03076:Gm5415 APN 1 32545545 missense probably damaging 1.00
IGL03288:Gm5415 APN 1 32545760 missense probably benign 0.09
PIT4576001:Gm5415 UTSW 1 32546472 missense probably damaging 1.00
R0110:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0510:Gm5415 UTSW 1 32545875 missense possibly damaging 0.87
R0891:Gm5415 UTSW 1 32546361 missense possibly damaging 0.54
R1836:Gm5415 UTSW 1 32545677 missense probably damaging 1.00
R1939:Gm5415 UTSW 1 32545546 missense probably damaging 0.99
R2156:Gm5415 UTSW 1 32546047 missense probably benign 0.08
R2226:Gm5415 UTSW 1 32545853 missense probably damaging 1.00
R2422:Gm5415 UTSW 1 32545861 missense possibly damaging 0.73
R4761:Gm5415 UTSW 1 32546507 missense possibly damaging 0.51
R4901:Gm5415 UTSW 1 32546620 missense probably benign 0.00
R5129:Gm5415 UTSW 1 32545479 missense probably damaging 1.00
R5129:Gm5415 UTSW 1 32545480 missense probably damaging 1.00
R5184:Gm5415 UTSW 1 32545648 missense probably damaging 0.99
R5259:Gm5415 UTSW 1 32545517 nonsense probably null
R6271:Gm5415 UTSW 1 32545491 missense probably damaging 1.00
R6746:Gm5415 UTSW 1 32546763 missense probably benign
R7720:Gm5415 UTSW 1 32546097 missense probably benign 0.00
X0024:Gm5415 UTSW 1 32545711 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTGTTACAACCTGCTCTGGAGG -3'
(R):5'- CCAGGCATAAGGTTGCTTTTG -3'

Sequencing Primer
(F):5'- AACCTGCTCTGGAGGACCTTC -3'
(R):5'- CTTTTGCTTGGAAAGTGAAAGAGCAC -3'
Posted On2018-06-22