Incidental Mutation 'R6622:Frmd4a'
ID524489
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6622 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4606062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1012 (T1012A)
Ref Sequence ENSEMBL: ENSMUSP00000134788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000176828] [ENSMUST00000177457]
Predicted Effect probably benign
Transcript: ENSMUST00000075767
AA Change: T997A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: T997A

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091497
AA Change: T1008A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: T1008A

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176828
AA Change: T703A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: T703A

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177457
AA Change: T1012A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: T1012A

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,244,222 A2563D probably damaging Het
6030419C18Rik A G 9: 58,499,250 I148V probably benign Het
Adgrl3 A C 5: 81,794,759 D1412A probably benign Het
Arhgap26 A G 18: 38,899,863 probably benign Het
Card14 A G 11: 119,333,988 M614V probably benign Het
Cbx2 A G 11: 119,029,135 T509A probably damaging Het
Cep135 A G 5: 76,640,968 D1136G probably benign Het
Cep170 T A 1: 176,756,332 Q827L probably damaging Het
Clock A T 5: 76,241,954 I349K probably damaging Het
Cnppd1 A T 1: 75,136,895 V243E probably damaging Het
Cops3 A G 11: 59,833,134 F93L probably damaging Het
Cxxc5 T G 18: 35,859,319 C258G possibly damaging Het
Cycs G A 6: 50,566,463 probably benign Het
Cyp2c40 A T 19: 39,802,546 H280Q probably damaging Het
Cyp4f14 C T 17: 32,914,645 R79H probably benign Het
Dnajc27 A G 12: 4,103,114 S197G probably benign Het
Dscam C T 16: 96,645,073 G1456E probably benign Het
Dst G A 1: 34,179,251 V1591I probably benign Het
Epha5 A G 5: 84,237,528 S315P possibly damaging Het
Fam46a G T 9: 85,326,456 R105S probably damaging Het
Fxr2 G A 11: 69,641,590 probably null Het
Gm12394 T A 4: 42,793,111 L340F probably damaging Het
Hcn4 T A 9: 58,857,727 V534E unknown Het
Hrh4 A G 18: 13,022,397 Y331C probably damaging Het
Kif16b T A 2: 142,712,442 H812L probably benign Het
Krt14 T A 11: 100,203,960 R451S probably benign Het
Man2b1 A G 8: 85,084,479 T80A probably damaging Het
Nedd4l A G 18: 65,174,234 T383A probably damaging Het
Pcdha9 T A 18: 36,998,654 L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 C131R probably damaging Het
Prrc2a C G 17: 35,155,420 R1418P probably damaging Het
Ptpa G T 2: 30,437,577 E114D probably damaging Het
Ptprt A T 2: 161,553,840 C1157S probably damaging Het
Rnf126 A T 10: 79,761,563 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sel1l3 A G 5: 53,139,860 V748A probably damaging Het
Serinc5 T A 13: 92,688,686 S208T probably benign Het
Sftpb A G 6: 72,305,655 I74V possibly damaging Het
Slc22a14 A C 9: 119,170,577 I516S possibly damaging Het
Slco2a1 G A 9: 103,074,505 C411Y possibly damaging Het
Tet3 G A 6: 83,403,444 P581S probably benign Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Tnrc6b T A 15: 80,879,184 W296R probably damaging Het
Trpm1 T A 7: 64,240,595 L982H probably damaging Het
Ttn C A 2: 76,720,518 R23183I possibly damaging Het
Tuft1 T A 3: 94,635,419 Y46F probably damaging Het
Vmn1r167 T A 7: 23,505,589 M1L probably null Het
Zfp808 A G 13: 62,171,832 R292G possibly damaging Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Zp2 C T 7: 120,141,913 M129I probably benign Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4591917 intron probably benign
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
R8399:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTGTCATTGACTTACGAGC -3'
(R):5'- TTTGTTTCAGCCCAGGAATCAC -3'

Sequencing Primer
(F):5'- GTCATTGACTTACGAGCTCCATG -3'
(R):5'- CCAGGAATCACTACCTACGTTTAAG -3'
Posted On2018-06-22