Incidental Mutation 'R6622:Ptpra'
ID 524490
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Name protein tyrosine phosphatase receptor type A
Synonyms PTP[a], RPTRalpha, PTPalpha, RPTPalpha, Ptpa
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130292198-130396220 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30327589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 114 (E114D)
Ref Sequence ENSEMBL: ENSMUSP00000109233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042055] [ENSMUST00000113601] [ENSMUST00000113603] [ENSMUST00000131476]
AlphaFold P18052
Predicted Effect probably damaging
Transcript: ENSMUST00000042055
AA Change: E156D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046837
Gene: ENSMUSG00000039515
AA Change: E156D

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 26 319 1.5e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113601
SMART Domains Protein: ENSMUSP00000109231
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 38 104 5.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113603
AA Change: E114D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109233
Gene: ENSMUSG00000039515
AA Change: E114D

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 64 280 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125561
SMART Domains Protein: ENSMUSP00000114290
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 125 6.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128516
Predicted Effect probably benign
Transcript: ENSMUST00000131476
SMART Domains Protein: ENSMUSP00000116268
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 61 8.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130,386,359 (GRCm39) missense probably damaging 1.00
IGL01734:Ptpra APN 2 130,385,997 (GRCm39) missense probably damaging 1.00
IGL02066:Ptpra APN 2 30,333,308 (GRCm39) missense possibly damaging 0.83
IGL02073:Ptpra APN 2 30,333,362 (GRCm39) missense probably damaging 1.00
IGL02201:Ptpra APN 2 30,336,389 (GRCm39) missense possibly damaging 0.91
IGL02218:Ptpra APN 2 130,394,255 (GRCm39) splice site probably benign
IGL02385:Ptpra APN 2 130,382,393 (GRCm39) unclassified probably benign
IGL02480:Ptpra APN 2 130,346,181 (GRCm39) missense probably benign 0.09
IGL03181:Ptpra APN 2 130,359,707 (GRCm39) missense probably damaging 0.99
R0374:Ptpra UTSW 2 130,379,541 (GRCm39) missense probably damaging 1.00
R0483:Ptpra UTSW 2 130,381,605 (GRCm39) missense probably damaging 1.00
R0848:Ptpra UTSW 2 130,360,911 (GRCm39) missense probably damaging 1.00
R1550:Ptpra UTSW 2 130,383,313 (GRCm39) missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130,386,872 (GRCm39) missense probably damaging 1.00
R1602:Ptpra UTSW 2 30,327,602 (GRCm39) missense probably benign 0.22
R1689:Ptpra UTSW 2 130,345,412 (GRCm39) missense probably benign 0.01
R1760:Ptpra UTSW 2 130,391,747 (GRCm39) missense probably damaging 1.00
R1943:Ptpra UTSW 2 130,386,024 (GRCm39) missense probably damaging 1.00
R2114:Ptpra UTSW 2 130,381,655 (GRCm39) missense probably damaging 1.00
R2115:Ptpra UTSW 2 130,381,655 (GRCm39) missense probably damaging 1.00
R2117:Ptpra UTSW 2 130,381,655 (GRCm39) missense probably damaging 1.00
R2187:Ptpra UTSW 2 130,346,219 (GRCm39) missense probably benign
R2848:Ptpra UTSW 2 130,386,919 (GRCm39) missense probably benign 0.06
R2849:Ptpra UTSW 2 130,386,919 (GRCm39) missense probably benign 0.06
R3962:Ptpra UTSW 2 30,325,672 (GRCm39) missense probably damaging 1.00
R4080:Ptpra UTSW 2 30,333,317 (GRCm39) missense probably damaging 1.00
R4644:Ptpra UTSW 2 130,386,078 (GRCm39) missense probably damaging 1.00
R4779:Ptpra UTSW 2 130,379,537 (GRCm39) missense probably damaging 1.00
R4849:Ptpra UTSW 2 130,374,081 (GRCm39) missense probably damaging 1.00
R4899:Ptpra UTSW 2 130,386,356 (GRCm39) missense probably damaging 1.00
R5186:Ptpra UTSW 2 30,328,367 (GRCm39) critical splice donor site probably null
R5657:Ptpra UTSW 2 130,346,204 (GRCm39) missense probably benign 0.06
R6018:Ptpra UTSW 2 130,345,422 (GRCm39) missense probably benign
R6234:Ptpra UTSW 2 130,379,508 (GRCm39) missense probably damaging 1.00
R6350:Ptpra UTSW 2 130,382,512 (GRCm39) missense probably damaging 1.00
R6856:Ptpra UTSW 2 130,361,301 (GRCm39) missense probably damaging 1.00
R7072:Ptpra UTSW 2 130,395,350 (GRCm39) missense probably damaging 1.00
R7146:Ptpra UTSW 2 130,379,571 (GRCm39) critical splice donor site probably null
R7220:Ptpra UTSW 2 130,386,417 (GRCm39) missense probably damaging 1.00
R7346:Ptpra UTSW 2 130,395,320 (GRCm39) missense probably damaging 1.00
R7819:Ptpra UTSW 2 130,346,126 (GRCm39) missense probably benign
R7943:Ptpra UTSW 2 30,322,056 (GRCm39) missense probably damaging 1.00
R8044:Ptpra UTSW 2 130,386,881 (GRCm39) missense possibly damaging 0.93
R8190:Ptpra UTSW 2 30,328,351 (GRCm39) missense probably damaging 1.00
R8231:Ptpra UTSW 2 130,379,523 (GRCm39) missense probably damaging 1.00
R8404:Ptpra UTSW 2 130,391,679 (GRCm39) missense probably damaging 1.00
R8422:Ptpra UTSW 2 130,374,091 (GRCm39) missense possibly damaging 0.86
R8502:Ptpra UTSW 2 130,391,679 (GRCm39) missense probably damaging 1.00
R8683:Ptpra UTSW 2 130,394,187 (GRCm39) missense possibly damaging 0.88
R8952:Ptpra UTSW 2 130,386,969 (GRCm39) missense probably damaging 1.00
R9147:Ptpra UTSW 2 30,328,256 (GRCm39) missense probably benign 0.21
R9147:Ptpra UTSW 2 30,328,255 (GRCm39) missense probably damaging 1.00
R9148:Ptpra UTSW 2 30,328,256 (GRCm39) missense probably benign 0.21
R9148:Ptpra UTSW 2 30,328,255 (GRCm39) missense probably damaging 1.00
R9717:Ptpra UTSW 2 130,384,366 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGGGTTTCTAATTGGTCAAACC -3'
(R):5'- TAAATTAGCCTCAGAACAGCGC -3'

Sequencing Primer
(F):5'- TTGGTCAAACCCATAAAGTAAGGTGC -3'
(R):5'- CAGCGCCTGTATGTGATGAAC -3'
Posted On 2018-06-22