Incidental Mutation 'R6589:Hspa4l'
ID 524496
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 044713-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R6589 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 40711487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 121 (L121V)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000203496] [ENSMUST00000203904] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect possibly damaging
Transcript: ENSMUST00000108086
AA Change: L100V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: L100V

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203267
Predicted Effect possibly damaging
Transcript: ENSMUST00000203353
AA Change: L121V

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757
AA Change: L121V

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203496
AA Change: L74V

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145243
Gene: ENSMUSG00000025757
AA Change: L74V

DomainStartEndE-ValueType
Pfam:HSP70 3 58 5.4e-16 PFAM
Pfam:HSP70 54 158 9.3e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203904
AA Change: L121V

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145405
Gene: ENSMUSG00000025757
AA Change: L121V

DomainStartEndE-ValueType
Pfam:HSP70 3 125 6.1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204702
AA Change: L121V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: L121V

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 G A 13: 112,485,397 (GRCm39) probably null Het
Asic2 G T 11: 80,777,430 (GRCm39) A427D possibly damaging Het
B3gnt2 T A 11: 22,787,117 (GRCm39) I24F probably damaging Het
BC030500 T C 8: 59,365,956 (GRCm39) probably benign Het
Cdh4 G A 2: 179,523,789 (GRCm39) probably null Het
Cramp1 T C 17: 25,196,466 (GRCm39) probably null Het
Fam72a A T 1: 131,461,554 (GRCm39) I80F probably damaging Het
Fbxo43 T C 15: 36,162,686 (GRCm39) T174A probably damaging Het
Fgf11 C A 11: 69,690,261 (GRCm39) V109L probably damaging Het
Fggy A G 4: 95,485,875 (GRCm39) I74V probably benign Het
Fshr T C 17: 89,296,035 (GRCm39) D224G probably damaging Het
Gm6465 A G 5: 11,898,128 (GRCm39) T81A possibly damaging Het
Hdac9 T C 12: 34,265,028 (GRCm39) E908G probably damaging Het
Klk1b16 A G 7: 43,790,894 (GRCm39) D232G probably benign Het
Lpl G T 8: 69,349,459 (GRCm39) M328I probably benign Het
Mgat4a T C 1: 37,483,976 (GRCm39) E498G probably damaging Het
Mup11 T A 4: 60,615,540 (GRCm39) Q91L possibly damaging Het
Myoc T A 1: 162,476,188 (GRCm39) Y297* probably null Het
Or14j5 T A 17: 38,161,727 (GRCm39) Y81* probably null Het
Semp2l1 A T 1: 32,585,792 (GRCm39) D39E probably benign Het
Siva1 A G 12: 112,613,272 (GRCm39) E40G probably damaging Het
Smarca2 T A 19: 26,597,284 (GRCm39) H55Q possibly damaging Het
Taf1b A G 12: 24,606,527 (GRCm39) E449G possibly damaging Het
Tafa2 T A 10: 123,540,297 (GRCm39) V51E probably damaging Het
Tcaf3 A T 6: 42,570,995 (GRCm39) N252K possibly damaging Het
Trim3 A G 7: 105,267,167 (GRCm39) L404P probably damaging Het
Vmn2r114 T C 17: 23,510,642 (GRCm39) T613A probably damaging Het
Vmn2r-ps158 T A 7: 42,673,022 (GRCm39) S142T possibly damaging Het
Zfp358 T A 8: 3,545,907 (GRCm39) F163Y probably damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGGCATGTCTAGTGTTAC -3'
(R):5'- ACAATGGGCTTTGAAGGTTTGC -3'

Sequencing Primer
(F):5'- AGGCATGTCTAGTGTTACTAGTTAC -3'
(R):5'- ATCAGAACCGACTTGATACAATTC -3'
Posted On 2018-06-22