Mutagenetix > Incidental Mutation

Incidental Mutation 'R6589:Tcaf3'

524504

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R6589 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 42594061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 252 (N252K)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]

AlphaFold

Q6QR59

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069023
AA Change: N252K

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: N252K

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134707

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.0%

Validation Efficiency

100% (26/26)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd55	G	A	13: 112,348,863		probably null	Het
Asic2	G	T	11: 80,886,604	A427D	possibly damaging	Het
B3gnt2	T	A	11: 22,837,117	I24F	probably damaging	Het
BC030500	T	C	8: 58,912,922		probably benign	Het
Cdh4	G	A	2: 179,881,996		probably null	Het
Cramp1l	T	C	17: 24,977,492		probably null	Het
Fam19a2	T	A	10: 123,704,392	V51E	probably damaging	Het
Fam72a	A	T	1: 131,533,816	I80F	probably damaging	Het
Fbxo43	T	C	15: 36,162,540	T174A	probably damaging	Het
Fgf11	C	A	11: 69,799,435	V109L	probably damaging	Het
Fggy	A	G	4: 95,597,638	I74V	probably benign	Het
Fshr	T	C	17: 88,988,607	D224G	probably damaging	Het
Gm5415	A	T	1: 32,546,711	D39E	probably benign	Het
Gm6465	A	G	5: 11,848,161	T81A	possibly damaging	Het
Gm9268	T	A	7: 43,023,598	S142T	possibly damaging	Het
Hdac9	T	C	12: 34,215,029	E908G	probably damaging	Het
Hspa4l	T	G	3: 40,757,055	L121V	probably damaging	Het
Klk1b16	A	G	7: 44,141,470	D232G	probably benign	Het
Lpl	G	T	8: 68,896,807	M328I	probably benign	Het
Mgat4a	T	C	1: 37,444,895	E498G	probably damaging	Het
Mup11	T	A	4: 60,659,541	Q91L	possibly damaging	Het
Myoc	T	A	1: 162,648,619	Y297*	probably null	Het
Olfr126	T	A	17: 37,850,836	Y81*	probably null	Het
Siva1	A	G	12: 112,646,838	E40G	probably damaging	Het
Smarca2	T	A	19: 26,619,884	H55Q	possibly damaging	Het
Taf1b	A	G	12: 24,556,528	E449G	possibly damaging	Het
Trim3	A	G	7: 105,617,960	L404P	probably damaging	Het
Vmn2r114	T	C	17: 23,291,668	T613A	probably damaging	Het
Zfp358	T	A	8: 3,495,907	F163Y	probably damaging	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9668:Tcaf3	UTSW	6	42589702	missense	probably damaging	1.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACACGCTCAAGTCACTGG -3'
(R):5'- CACACTCACTTCTTTTGCAGAG -3'

Sequencing Primer
(F):5'- CGCTCAAGTCACTGGTTAGAAGTTC -3'
(R):5'- CAGAGTCTGATGTGAGAACTGTCTC -3'

Posted On

2018-06-22