Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Epha5'

524511

Institutional Source

Beutler Lab

Gene Symbol

Epha5

Ensembl Gene

ENSMUSG00000029245

Gene Name

Eph receptor A5

Synonyms

Rek7, Ehk1, Hek7, Cek7, bsk, Els1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84054761-84417382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84237528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 315 (S315P)

Ref Sequence

ENSEMBL: ENSMUSP00000109026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]

AlphaFold

Q60629

Predicted Effect

probably benign
Transcript: ENSMUST00000053733

SMART Domains

Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	413	511	2.1e-22	PFAM
TyrKc	514	771	9.33e-138	SMART
SAM	801	868	6.65e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113398
AA Change: S315P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: S315P

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	359	439	1.92e-12	SMART
Pfam:EphA2_TM	465	563	8.4e-23	PFAM
TyrKc	566	823	9.33e-138	SMART
Pfam:SAM_1	854	894	7.2e-11	PFAM
Pfam:SAM_2	856	894	1.6e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113399
AA Change: S315P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: S315P

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	3.4e-22	PFAM
TyrKc	678	935	9.33e-138	SMART
Pfam:SAM_1	966	1006	2.9e-10	PFAM
Pfam:SAM_2	968	1006	5.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113401

SMART Domains

Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	411	488	3.1e-30	PFAM
TyrKc	491	748	9.33e-138	SMART
Pfam:SAM_1	779	819	1.7e-10	PFAM
Pfam:SAM_2	781	819	3.5e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113403
AA Change: S315P

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: S315P

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	1.2e-25	PFAM
TyrKc	678	935	9.33e-138	SMART
SAM	965	1032	6.65e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113406
AA Change: S315P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: S315P

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	575	652	1.9e-30	PFAM
TyrKc	655	912	9.33e-138	SMART
SAM	942	1009	6.65e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154804

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155469

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Epha5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00808:Epha5	APN	5	84106700	missense	probably damaging	1.00
IGL01084:Epha5	APN	5	84071087	nonsense	probably null
IGL01462:Epha5	APN	5	84071233	missense	probably damaging	1.00
IGL01516:Epha5	APN	5	84386276	missense	probably damaging	1.00
IGL01998:Epha5	APN	5	84084734	missense	probably damaging	1.00
IGL02744:Epha5	APN	5	84107989	missense	probably benign	0.22
IGL03076:Epha5	APN	5	84331690	missense	probably damaging	1.00
IGL03123:Epha5	APN	5	84331226	critical splice donor site	probably null
IGL03381:Epha5	APN	5	84331332	missense	probably damaging	0.98
BB001:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
BB011:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
PIT4544001:Epha5	UTSW	5	84331612	missense	possibly damaging	0.71
R0004:Epha5	UTSW	5	84331842	missense	probably damaging	1.00
R0490:Epha5	UTSW	5	84107974	splice site	probably benign
R0545:Epha5	UTSW	5	84067358	critical splice donor site	probably null
R0835:Epha5	UTSW	5	84386242	missense	probably damaging	1.00
R1074:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1074:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1102:Epha5	UTSW	5	84233575	splice site	probably benign
R1184:Epha5	UTSW	5	84071275	splice site	probably null
R1255:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1255:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1327:Epha5	UTSW	5	84106785	missense	probably damaging	1.00
R1437:Epha5	UTSW	5	84233696	missense	probably damaging	1.00
R1804:Epha5	UTSW	5	84331815	missense	probably benign	0.21
R1967:Epha5	UTSW	5	84416429	missense	probably benign	0.23
R2187:Epha5	UTSW	5	84086364	missense	probably damaging	1.00
R2282:Epha5	UTSW	5	84150410	missense	probably damaging	1.00
R2899:Epha5	UTSW	5	84233808	missense	probably damaging	0.99
R3746:Epha5	UTSW	5	84059104	missense	probably damaging	1.00
R4454:Epha5	UTSW	5	84156444	missense	probably damaging	1.00
R4771:Epha5	UTSW	5	84150419	missense	probably damaging	0.99
R4809:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4810:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4825:Epha5	UTSW	5	84233840	missense	probably damaging	0.97
R4833:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4961:Epha5	UTSW	5	84233643	missense	probably damaging	1.00
R4976:Epha5	UTSW	5	84084824	missense	probably damaging	1.00
R4981:Epha5	UTSW	5	84150483	missense	probably damaging	1.00
R5149:Epha5	UTSW	5	84150358	missense	probably damaging	1.00
R5422:Epha5	UTSW	5	84331490	missense	probably damaging	1.00
R5575:Epha5	UTSW	5	84416502	missense	probably damaging	0.97
R5664:Epha5	UTSW	5	84331866	missense	probably damaging	1.00
R5801:Epha5	UTSW	5	84331226	critical splice donor site	probably null
R5821:Epha5	UTSW	5	84084728	missense	probably damaging	1.00
R5924:Epha5	UTSW	5	84233674	nonsense	probably null
R5951:Epha5	UTSW	5	84331192	intron	probably benign
R5956:Epha5	UTSW	5	84150369	missense	probably damaging	0.99
R6127:Epha5	UTSW	5	84071094	missense	probably damaging	1.00
R6189:Epha5	UTSW	5	84237540	missense	probably damaging	1.00
R6240:Epha5	UTSW	5	84117579	missense	probably benign	0.27
R6343:Epha5	UTSW	5	84106747	missense	probably damaging	1.00
R6463:Epha5	UTSW	5	84106710	missense	probably damaging	1.00
R6517:Epha5	UTSW	5	84156501	missense	possibly damaging	0.63
R6667:Epha5	UTSW	5	84071191	missense	probably damaging	1.00
R6741:Epha5	UTSW	5	84106698	missense	possibly damaging	0.69
R6757:Epha5	UTSW	5	84105878	missense	probably damaging	1.00
R6762:Epha5	UTSW	5	84331726	missense	probably damaging	1.00
R6819:Epha5	UTSW	5	84106790	missense	probably damaging	1.00
R7019:Epha5	UTSW	5	84416462	missense	possibly damaging	0.68
R7031:Epha5	UTSW	5	84142300	missense	probably benign	0.12
R7213:Epha5	UTSW	5	84233923	splice site	probably null
R7728:Epha5	UTSW	5	84067408	missense	possibly damaging	0.95
R7924:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
R7953:Epha5	UTSW	5	84233654	missense	probably benign	0.19
R8043:Epha5	UTSW	5	84233654	missense	probably benign	0.19
R8468:Epha5	UTSW	5	84142416	splice site	probably null
R8558:Epha5	UTSW	5	84059116	missense	probably damaging	1.00
R8796:Epha5	UTSW	5	84107991	missense	probably damaging	0.97
R9035:Epha5	UTSW	5	84108027	missense	probably damaging	1.00
R9060:Epha5	UTSW	5	84071118	missense	probably benign	0.01
R9244:Epha5	UTSW	5	84117582	missense	probably benign	0.28
R9347:Epha5	UTSW	5	84331872	missense	possibly damaging	0.51
R9355:Epha5	UTSW	5	84106031	missense	probably damaging	1.00
R9434:Epha5	UTSW	5	84331368	missense	possibly damaging	0.72
Z1088:Epha5	UTSW	5	84237522	missense	probably benign	0.01
Z1176:Epha5	UTSW	5	84071120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGCTGTTTCTCCAGACTGGC -3'
(R):5'- CCTGATGATCTGAATGGTCTGAGAAG -3'

Sequencing Primer
(F):5'- TTTCTCCAGACTGGCGAAAG -3'
(R):5'- TCTGAATGGTCTGAGAAGAGTCATC -3'

Posted On

2018-06-22