Incidental Mutation 'R6622:Epha5'
ID 524511
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene Name Eph receptor A5
Synonyms Rek7, Cek7, Els1, Ehk1, Hek7, bsk
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 84202620-84565241 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84385387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 315 (S315P)
Ref Sequence ENSEMBL: ENSMUSP00000109026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
AlphaFold Q60629
Predicted Effect probably benign
Transcript: ENSMUST00000053733
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113398
AA Change: S315P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113399
AA Change: S315P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113401
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113403
AA Change: S315P

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113406
AA Change: S315P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152573
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84,254,559 (GRCm39) missense probably damaging 1.00
IGL01084:Epha5 APN 5 84,218,946 (GRCm39) nonsense probably null
IGL01462:Epha5 APN 5 84,219,092 (GRCm39) missense probably damaging 1.00
IGL01516:Epha5 APN 5 84,534,135 (GRCm39) missense probably damaging 1.00
IGL01998:Epha5 APN 5 84,232,593 (GRCm39) missense probably damaging 1.00
IGL02744:Epha5 APN 5 84,255,848 (GRCm39) missense probably benign 0.22
IGL03076:Epha5 APN 5 84,479,549 (GRCm39) missense probably damaging 1.00
IGL03123:Epha5 APN 5 84,479,085 (GRCm39) critical splice donor site probably null
IGL03381:Epha5 APN 5 84,479,191 (GRCm39) missense probably damaging 0.98
BB001:Epha5 UTSW 5 84,232,705 (GRCm39) missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84,232,705 (GRCm39) missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84,479,471 (GRCm39) missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84,479,701 (GRCm39) missense probably damaging 1.00
R0490:Epha5 UTSW 5 84,255,833 (GRCm39) splice site probably benign
R0545:Epha5 UTSW 5 84,215,217 (GRCm39) critical splice donor site probably null
R0835:Epha5 UTSW 5 84,534,101 (GRCm39) missense probably damaging 1.00
R1074:Epha5 UTSW 5 84,298,255 (GRCm39) missense probably damaging 0.99
R1074:Epha5 UTSW 5 84,298,254 (GRCm39) missense probably damaging 0.99
R1075:Epha5 UTSW 5 84,298,255 (GRCm39) missense probably damaging 0.99
R1075:Epha5 UTSW 5 84,298,254 (GRCm39) missense probably damaging 0.99
R1102:Epha5 UTSW 5 84,381,434 (GRCm39) splice site probably benign
R1184:Epha5 UTSW 5 84,219,134 (GRCm39) splice site probably null
R1255:Epha5 UTSW 5 84,298,255 (GRCm39) missense probably damaging 0.99
R1255:Epha5 UTSW 5 84,298,254 (GRCm39) missense probably damaging 0.99
R1327:Epha5 UTSW 5 84,254,644 (GRCm39) missense probably damaging 1.00
R1437:Epha5 UTSW 5 84,381,555 (GRCm39) missense probably damaging 1.00
R1804:Epha5 UTSW 5 84,479,674 (GRCm39) missense probably benign 0.21
R1967:Epha5 UTSW 5 84,564,288 (GRCm39) missense probably benign 0.23
R2187:Epha5 UTSW 5 84,234,223 (GRCm39) missense probably damaging 1.00
R2282:Epha5 UTSW 5 84,298,269 (GRCm39) missense probably damaging 1.00
R2899:Epha5 UTSW 5 84,381,667 (GRCm39) missense probably damaging 0.99
R3746:Epha5 UTSW 5 84,206,963 (GRCm39) missense probably damaging 1.00
R4454:Epha5 UTSW 5 84,304,303 (GRCm39) missense probably damaging 1.00
R4771:Epha5 UTSW 5 84,298,278 (GRCm39) missense probably damaging 0.99
R4809:Epha5 UTSW 5 84,253,750 (GRCm39) missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84,253,750 (GRCm39) missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84,381,699 (GRCm39) missense probably damaging 0.97
R4833:Epha5 UTSW 5 84,253,750 (GRCm39) missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84,381,502 (GRCm39) missense probably damaging 1.00
R4976:Epha5 UTSW 5 84,232,683 (GRCm39) missense probably damaging 1.00
R4981:Epha5 UTSW 5 84,298,342 (GRCm39) missense probably damaging 1.00
R5149:Epha5 UTSW 5 84,298,217 (GRCm39) missense probably damaging 1.00
R5422:Epha5 UTSW 5 84,479,349 (GRCm39) missense probably damaging 1.00
R5575:Epha5 UTSW 5 84,564,361 (GRCm39) missense probably damaging 0.97
R5664:Epha5 UTSW 5 84,479,725 (GRCm39) missense probably damaging 1.00
R5801:Epha5 UTSW 5 84,479,085 (GRCm39) critical splice donor site probably null
R5821:Epha5 UTSW 5 84,232,587 (GRCm39) missense probably damaging 1.00
R5924:Epha5 UTSW 5 84,381,533 (GRCm39) nonsense probably null
R5951:Epha5 UTSW 5 84,479,051 (GRCm39) intron probably benign
R5956:Epha5 UTSW 5 84,298,228 (GRCm39) missense probably damaging 0.99
R6127:Epha5 UTSW 5 84,218,953 (GRCm39) missense probably damaging 1.00
R6189:Epha5 UTSW 5 84,385,399 (GRCm39) missense probably damaging 1.00
R6240:Epha5 UTSW 5 84,265,438 (GRCm39) missense probably benign 0.27
R6343:Epha5 UTSW 5 84,254,606 (GRCm39) missense probably damaging 1.00
R6463:Epha5 UTSW 5 84,254,569 (GRCm39) missense probably damaging 1.00
R6517:Epha5 UTSW 5 84,304,360 (GRCm39) missense possibly damaging 0.63
R6667:Epha5 UTSW 5 84,219,050 (GRCm39) missense probably damaging 1.00
R6741:Epha5 UTSW 5 84,254,557 (GRCm39) missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84,253,737 (GRCm39) missense probably damaging 1.00
R6762:Epha5 UTSW 5 84,479,585 (GRCm39) missense probably damaging 1.00
R6819:Epha5 UTSW 5 84,254,649 (GRCm39) missense probably damaging 1.00
R7019:Epha5 UTSW 5 84,564,321 (GRCm39) missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84,290,159 (GRCm39) missense probably benign 0.12
R7213:Epha5 UTSW 5 84,381,782 (GRCm39) splice site probably null
R7728:Epha5 UTSW 5 84,215,267 (GRCm39) missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84,232,705 (GRCm39) missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84,381,513 (GRCm39) missense probably benign 0.19
R8043:Epha5 UTSW 5 84,381,513 (GRCm39) missense probably benign 0.19
R8468:Epha5 UTSW 5 84,290,275 (GRCm39) splice site probably null
R8558:Epha5 UTSW 5 84,206,975 (GRCm39) missense probably damaging 1.00
R8796:Epha5 UTSW 5 84,255,850 (GRCm39) missense probably damaging 0.97
R9035:Epha5 UTSW 5 84,255,886 (GRCm39) missense probably damaging 1.00
R9060:Epha5 UTSW 5 84,218,977 (GRCm39) missense probably benign 0.01
R9244:Epha5 UTSW 5 84,265,441 (GRCm39) missense probably benign 0.28
R9347:Epha5 UTSW 5 84,479,731 (GRCm39) missense possibly damaging 0.51
R9355:Epha5 UTSW 5 84,253,890 (GRCm39) missense probably damaging 1.00
R9434:Epha5 UTSW 5 84,479,227 (GRCm39) missense possibly damaging 0.72
Z1088:Epha5 UTSW 5 84,385,381 (GRCm39) missense probably benign 0.01
Z1176:Epha5 UTSW 5 84,218,979 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCTGTTTCTCCAGACTGGC -3'
(R):5'- CCTGATGATCTGAATGGTCTGAGAAG -3'

Sequencing Primer
(F):5'- TTTCTCCAGACTGGCGAAAG -3'
(R):5'- TCTGAATGGTCTGAGAAGAGTCATC -3'
Posted On 2018-06-22