Incidental Mutation 'R6622:Sftpb'
ID 524514
Institutional Source Beutler Lab
Gene Symbol Sftpb
Ensembl Gene ENSMUSG00000056370
Gene Name surfactant associated protein B
Synonyms SF-B, Sftp-3, Sftp3, SP-B
Accession Numbers
Essential gene? Possibly essential (E-score: 0.629) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 72281594-72291354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72282639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 74 (I74V)
Ref Sequence ENSEMBL: ENSMUSP00000066805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070437] [ENSMUST00000182014] [ENSMUST00000183018] [ENSMUST00000183278]
AlphaFold P50405
Predicted Effect possibly damaging
Transcript: ENSMUST00000070437
AA Change: I74V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066805
Gene: ENSMUSG00000056370
AA Change: I74V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
SapB 197 267 7.13e-10 SMART
SapB 292 361 2.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182014
AA Change: I74V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138204
Gene: ENSMUSG00000056370
AA Change: I74V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182765
SMART Domains Protein: ENSMUSP00000138298
Gene: ENSMUSG00000056370

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
Blast:SapB 43 91 1e-20 BLAST
PDB:2JOU|A 45 92 1e-7 PDB
SapB 116 185 2.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183018
AA Change: I74V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138695
Gene: ENSMUSG00000056370
AA Change: I74V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
Blast:SapB 197 245 3e-19 BLAST
PDB:2JOU|A 199 246 3e-7 PDB
SapB 270 339 2.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183278
AA Change: I74V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138485
Gene: ENSMUSG00000056370
AA Change: I74V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
PHENOTYPE: Inactivation of this gene results in respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Sftpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Sftpb APN 6 72,286,845 (GRCm39) missense probably benign 0.03
IGL02013:Sftpb APN 6 72,282,655 (GRCm39) missense probably benign 0.08
R1741:Sftpb UTSW 6 72,282,797 (GRCm39) missense probably benign 0.03
R2159:Sftpb UTSW 6 72,286,770 (GRCm39) missense probably damaging 1.00
R5108:Sftpb UTSW 6 72,281,640 (GRCm39) missense probably damaging 1.00
R5315:Sftpb UTSW 6 72,283,876 (GRCm39) missense probably benign 0.31
R5506:Sftpb UTSW 6 72,281,651 (GRCm39) missense possibly damaging 0.46
R6415:Sftpb UTSW 6 72,281,633 (GRCm39) missense probably damaging 0.96
R7130:Sftpb UTSW 6 72,282,808 (GRCm39) missense possibly damaging 0.89
R7342:Sftpb UTSW 6 72,286,858 (GRCm39) missense probably benign 0.01
R7527:Sftpb UTSW 6 72,282,048 (GRCm39) missense possibly damaging 0.69
R7644:Sftpb UTSW 6 72,286,818 (GRCm39) missense probably benign 0.27
R9291:Sftpb UTSW 6 72,286,880 (GRCm39) nonsense probably null
R9365:Sftpb UTSW 6 72,284,189 (GRCm39) nonsense probably null
R9432:Sftpb UTSW 6 72,283,843 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGGAATTTGCACAATGG -3'
(R):5'- GGTAGACATCAAGCACTTGGC -3'

Sequencing Primer
(F):5'- TTTGCACAATGGGATGAGATGG -3'
(R):5'- GGGAAGGATATCACATTCTTGTTCC -3'
Posted On 2018-06-22