Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Tet3'

524517

Institutional Source

Beutler Lab

Gene Symbol

Tet3

Ensembl Gene

ENSMUSG00000034832

Gene Name

tet methylcytosine dioxygenase 3

Synonyms

D230004J03Rik, B430006D22Rik

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.643) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83362373-83459084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83403444 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 581 (P581S)

Ref Sequence

ENSEMBL: ENSMUSP00000139630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]

AlphaFold

Q8BG87

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000056191

Predicted Effect

probably benign
Transcript: ENSMUST00000089622
AA Change: P446S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: P446S

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
low complexity region	66	77	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
internal_repeat_1	160	277	4.9e-5	PROSPERO
low complexity region	279	297	N/A	INTRINSIC
low complexity region	359	371	N/A	INTRINSIC
low complexity region	418	456	N/A	INTRINSIC
Tet_JBP	858	1570	N/A	SMART
coiled coil region	1579	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184003

Predicted Effect

probably benign
Transcript: ENSMUST00000186548
AA Change: P581S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: P581S

Domain	Start	End	E-Value	Type
Pfam:zf-CXXC	49	89	8e-6	PFAM
low complexity region	162	173	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	250	261	N/A	INTRINSIC
internal_repeat_1	295	412	5.5e-5	PROSPERO
low complexity region	414	432	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
low complexity region	553	591	N/A	INTRINSIC
Tet_JBP	993	1705	N/A	SMART
coiled coil region	1714	1738	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190295

SMART Domains

Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

Domain	Start	End	E-Value	Type
low complexity region	72	83	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Tet3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Tet3	APN	6	83368655	missense	probably benign	0.06
IGL01396:Tet3	APN	6	83369638	nonsense	probably null
IGL02344:Tet3	APN	6	83403833	missense	probably benign	0.04
IGL02987:Tet3	APN	6	83368092	missense	probably damaging	0.99
IGL03126:Tet3	APN	6	83376787	missense	probably damaging	1.00
IGL03155:Tet3	APN	6	83368383	missense	probably damaging	1.00
IGL03286:Tet3	APN	6	83375778	missense	probably damaging	1.00
Reedy	UTSW	6	83368084	nonsense	probably null
P0033:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R0131:Tet3	UTSW	6	83368788	missense	probably damaging	1.00
R0295:Tet3	UTSW	6	83369139	missense	probably benign	0.14
R0504:Tet3	UTSW	6	83373794	missense	probably damaging	1.00
R0524:Tet3	UTSW	6	83379942	missense	probably damaging	1.00
R1061:Tet3	UTSW	6	83373323	missense	probably damaging	0.99
R1160:Tet3	UTSW	6	83404452	missense	probably benign	0.00
R1550:Tet3	UTSW	6	83386028	missense	probably damaging	0.97
R1640:Tet3	UTSW	6	83369315	missense	probably benign	0.44
R1658:Tet3	UTSW	6	83369057	missense	probably benign	0.44
R1746:Tet3	UTSW	6	83368068	missense	probably damaging	1.00
R1761:Tet3	UTSW	6	83403659	missense	probably damaging	0.99
R1832:Tet3	UTSW	6	83403645	missense	probably benign
R1835:Tet3	UTSW	6	83404163	missense	possibly damaging	0.95
R1932:Tet3	UTSW	6	83404379	missense	possibly damaging	0.94
R2014:Tet3	UTSW	6	83386075	missense	probably damaging	1.00
R2230:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2232:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2922:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R3429:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R3430:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R4291:Tet3	UTSW	6	83373199	missense	probably damaging	1.00
R4349:Tet3	UTSW	6	83403275	missense	probably benign
R4809:Tet3	UTSW	6	83402946	missense	probably benign
R4846:Tet3	UTSW	6	83376883	nonsense	probably null
R5039:Tet3	UTSW	6	83375896	missense	probably damaging	1.00
R5233:Tet3	UTSW	6	83386063	missense	probably damaging	1.00
R5363:Tet3	UTSW	6	83376764	critical splice donor site	probably null
R5880:Tet3	UTSW	6	83370550	missense	probably damaging	1.00
R6270:Tet3	UTSW	6	83375791	missense	possibly damaging	0.86
R6277:Tet3	UTSW	6	83368084	nonsense	probably null
R6564:Tet3	UTSW	6	83386070	missense	possibly damaging	0.92
R7089:Tet3	UTSW	6	83455024	missense	possibly damaging	0.46
R7244:Tet3	UTSW	6	83370621	missense	probably damaging	1.00
R7251:Tet3	UTSW	6	83404056	missense	probably benign
R7361:Tet3	UTSW	6	83368094	missense	probably benign	0.15
R7436:Tet3	UTSW	6	83368229	small insertion	probably benign
R7438:Tet3	UTSW	6	83368229	small insertion	probably benign
R7544:Tet3	UTSW	6	83404641	missense	probably damaging	1.00
R7552:Tet3	UTSW	6	83368307	missense	probably damaging	1.00
R7942:Tet3	UTSW	6	83376974	missense	probably damaging	1.00
R8010:Tet3	UTSW	6	83403246	missense	unknown
R8063:Tet3	UTSW	6	83402741	missense	probably damaging	1.00
R8307:Tet3	UTSW	6	83379927	missense	probably damaging	1.00
R9016:Tet3	UTSW	6	83368271	missense	probably damaging	1.00
R9020:Tet3	UTSW	6	83404436	missense	probably damaging	1.00
R9377:Tet3	UTSW	6	83403614	missense	possibly damaging	0.95
R9476:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9476:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9510:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9510:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9582:Tet3	UTSW	6	83404244	missense	probably damaging	0.99
R9671:Tet3	UTSW	6	83404154	missense	possibly damaging	0.89
R9801:Tet3	UTSW	6	83369454	missense	possibly damaging	0.94
X0004:Tet3	UTSW	6	83403423	missense	probably benign	0.17
Z1176:Tet3	UTSW	6	83370698	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83404350	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83459021	missense	unknown
Z1177:Tet3	UTSW	6	83404294	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TAACGGTGCCTGTCCTTCTGAG -3'
(R):5'- CTATTTCTCAGAGGGAGGCTCC -3'

Sequencing Primer
(F):5'- CCTGTCCTTCTGAGGCTTGG -3'
(R):5'- GCTGTCTTCAGAGCCTGACAC -3'

Posted On

2018-06-22