Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Trpm1'

524520

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64240595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 982 (L982H)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: L982H

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L982H

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: L866H

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: L982H

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATCCTCATGTCGGAACCAGG -3'
(R):5'- TTATGAAGATGTCAGCATGCAGG -3'

Sequencing Primer
(F):5'- TGTCGGAACCAGGCAAACTC -3'
(R):5'- GCAATTGCATGTGTTAAGCCAGC -3'

Posted On

2018-06-22