Incidental Mutation 'R6589:Asic2'
ID524525
Institutional Source Beutler Lab
Gene Symbol Asic2
Ensembl Gene ENSMUSG00000020704
Gene Nameacid-sensing (proton-gated) ion channel 2
SynonymsMdeg, BNC1, BNaC1a, Accn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6589 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80880169-81968457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80886604 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 427 (A427D)
Ref Sequence ENSEMBL: ENSMUSP00000067095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021045] [ENSMUST00000066197]
Predicted Effect probably benign
Transcript: ENSMUST00000021045
AA Change: A478D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021045
Gene: ENSMUSG00000020704
AA Change: A478D

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
Pfam:ASC 61 504 6.7e-94 PFAM
low complexity region 507 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066197
AA Change: A427D

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067095
Gene: ENSMUSG00000020704
AA Change: A427D

DomainStartEndE-ValueType
Pfam:ASC 20 454 3.3e-177 PFAM
low complexity region 456 472 N/A INTRINSIC
Meta Mutation Damage Score 0.2476 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mechanoreceptor and spiral ganglion electrophysiology and decreased pressure-induced blood vessel constriction. Mice homozygous for a different knock-out allele exhibit retinal degeneration and abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 G A 13: 112,348,863 probably null Het
B3gnt2 T A 11: 22,837,117 I24F probably damaging Het
BC030500 T C 8: 58,912,922 probably benign Het
Cdh4 G A 2: 179,881,996 probably null Het
Cramp1l T C 17: 24,977,492 probably null Het
Fam19a2 T A 10: 123,704,392 V51E probably damaging Het
Fam72a A T 1: 131,533,816 I80F probably damaging Het
Fbxo43 T C 15: 36,162,540 T174A probably damaging Het
Fgf11 C A 11: 69,799,435 V109L probably damaging Het
Fggy A G 4: 95,597,638 I74V probably benign Het
Fshr T C 17: 88,988,607 D224G probably damaging Het
Gm5415 A T 1: 32,546,711 D39E probably benign Het
Gm6465 A G 5: 11,848,161 T81A possibly damaging Het
Gm9268 T A 7: 43,023,598 S142T possibly damaging Het
Hdac9 T C 12: 34,215,029 E908G probably damaging Het
Hspa4l T G 3: 40,757,055 L121V probably damaging Het
Klk1b16 A G 7: 44,141,470 D232G probably benign Het
Lpl G T 8: 68,896,807 M328I probably benign Het
Mgat4a T C 1: 37,444,895 E498G probably damaging Het
Mup11 T A 4: 60,659,541 Q91L possibly damaging Het
Myoc T A 1: 162,648,619 Y297* probably null Het
Olfr126 T A 17: 37,850,836 Y81* probably null Het
Siva1 A G 12: 112,646,838 E40G probably damaging Het
Smarca2 T A 19: 26,619,884 H55Q possibly damaging Het
Taf1b A G 12: 24,556,528 E449G possibly damaging Het
Tcaf3 A T 6: 42,594,061 N252K possibly damaging Het
Trim3 A G 7: 105,617,960 L404P probably damaging Het
Vmn2r114 T C 17: 23,291,668 T613A probably damaging Het
Zfp358 T A 8: 3,495,907 F163Y probably damaging Het
Other mutations in Asic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Asic2 APN 11 80894030 missense probably damaging 0.99
IGL02420:Asic2 APN 11 80881653 missense probably benign 0.05
IGL02451:Asic2 APN 11 80891737 splice site probably benign
LCD18:Asic2 UTSW 11 80985744 intron probably benign
R0682:Asic2 UTSW 11 80886680 missense possibly damaging 0.67
R0718:Asic2 UTSW 11 80971456 splice site probably benign
R0784:Asic2 UTSW 11 80893989 missense possibly damaging 0.92
R2679:Asic2 UTSW 11 81151954 missense probably benign 0.13
R2883:Asic2 UTSW 11 80894013 missense possibly damaging 0.61
R2991:Asic2 UTSW 11 81968037 missense probably benign
R4722:Asic2 UTSW 11 81968183 start codon destroyed probably null 0.00
R4770:Asic2 UTSW 11 80971492 missense probably benign 0.07
R4900:Asic2 UTSW 11 81573454 intron probably benign
R5005:Asic2 UTSW 11 80883426 missense probably damaging 1.00
R5056:Asic2 UTSW 11 80971603 missense possibly damaging 0.64
R5344:Asic2 UTSW 11 80971587 missense probably damaging 1.00
R5490:Asic2 UTSW 11 80889820 missense probably benign 0.02
R5722:Asic2 UTSW 11 81967980 missense probably benign 0.07
R6072:Asic2 UTSW 11 80894088 missense probably damaging 0.97
R7068:Asic2 UTSW 11 81152255 missense probably benign 0.01
R7226:Asic2 UTSW 11 80971514 missense probably damaging 1.00
R7593:Asic2 UTSW 11 81967831 missense probably benign 0.01
R7869:Asic2 UTSW 11 81967998 missense probably damaging 1.00
R7952:Asic2 UTSW 11 81967998 missense probably damaging 1.00
Z1176:Asic2 UTSW 11 80889832 missense not run
Z1176:Asic2 UTSW 11 81967670 missense not run
Z1177:Asic2 UTSW 11 80894011 missense not run
Z1177:Asic2 UTSW 11 81152090 missense not run
Z1177:Asic2 UTSW 11 81152240 missense not run
Predicted Primers PCR Primer
(F):5'- GGACCTATAGCCTTTACCACAG -3'
(R):5'- ACAGCTGATAGGAGCTCTGC -3'

Sequencing Primer
(F):5'- TATAGCCTTTACCACAGCAACC -3'
(R):5'- AGAATTCTACCTTTGGACAGCTC -3'
Posted On2018-06-22