Incidental Mutation 'R6622:Zp2'
ID 524526
Institutional Source Beutler Lab
Gene Symbol Zp2
Ensembl Gene ENSMUSG00000030911
Gene Name zona pellucida glycoprotein 2
Synonyms Zp-2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119725995-119744514 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119741136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 129 (M129I)
Ref Sequence ENSEMBL: ENSMUSP00000147097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]
AlphaFold P20239
Predicted Effect probably benign
Transcript: ENSMUST00000033207
AA Change: M129I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: M129I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
ZP 364 630 1.06e-86 SMART
low complexity region 655 668 N/A INTRINSIC
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207333
Predicted Effect probably benign
Transcript: ENSMUST00000207726
AA Change: M129I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208122
Predicted Effect probably benign
Transcript: ENSMUST00000208874
AA Change: M129I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Other mutations in Zp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Zp2 APN 7 119,732,623 (GRCm39) missense probably benign 0.00
IGL00707:Zp2 APN 7 119,732,636 (GRCm39) missense probably benign 0.03
IGL00916:Zp2 APN 7 119,737,397 (GRCm39) missense probably damaging 1.00
IGL01554:Zp2 APN 7 119,737,548 (GRCm39) missense possibly damaging 0.78
IGL01845:Zp2 APN 7 119,737,414 (GRCm39) missense probably damaging 1.00
IGL02111:Zp2 APN 7 119,731,641 (GRCm39) missense possibly damaging 0.75
IGL02145:Zp2 APN 7 119,739,074 (GRCm39) critical splice acceptor site probably null
IGL02155:Zp2 APN 7 119,743,340 (GRCm39) missense probably benign 0.00
IGL02178:Zp2 APN 7 119,732,973 (GRCm39) missense possibly damaging 0.85
IGL02646:Zp2 APN 7 119,734,564 (GRCm39) missense possibly damaging 0.92
IGL03220:Zp2 APN 7 119,736,450 (GRCm39) missense possibly damaging 0.90
PIT4687001:Zp2 UTSW 7 119,741,102 (GRCm39) missense probably benign 0.00
R0138:Zp2 UTSW 7 119,736,423 (GRCm39) missense probably damaging 0.96
R0197:Zp2 UTSW 7 119,742,799 (GRCm39) splice site probably benign
R0519:Zp2 UTSW 7 119,737,372 (GRCm39) missense probably damaging 1.00
R0573:Zp2 UTSW 7 119,734,693 (GRCm39) splice site probably benign
R0879:Zp2 UTSW 7 119,734,757 (GRCm39) missense probably damaging 1.00
R0883:Zp2 UTSW 7 119,742,799 (GRCm39) splice site probably benign
R1160:Zp2 UTSW 7 119,735,268 (GRCm39) missense probably damaging 1.00
R1235:Zp2 UTSW 7 119,737,566 (GRCm39) missense possibly damaging 0.57
R1753:Zp2 UTSW 7 119,737,328 (GRCm39) missense probably benign
R1883:Zp2 UTSW 7 119,732,624 (GRCm39) missense probably benign 0.02
R1995:Zp2 UTSW 7 119,734,388 (GRCm39) missense probably damaging 0.97
R2196:Zp2 UTSW 7 119,737,529 (GRCm39) missense probably benign
R2850:Zp2 UTSW 7 119,737,529 (GRCm39) missense probably benign
R3715:Zp2 UTSW 7 119,741,057 (GRCm39) missense possibly damaging 0.95
R3931:Zp2 UTSW 7 119,731,580 (GRCm39) intron probably benign
R4082:Zp2 UTSW 7 119,734,475 (GRCm39) missense probably benign 0.01
R4731:Zp2 UTSW 7 119,737,343 (GRCm39) missense probably damaging 0.96
R4732:Zp2 UTSW 7 119,737,343 (GRCm39) missense probably damaging 0.96
R4733:Zp2 UTSW 7 119,737,343 (GRCm39) missense probably damaging 0.96
R4754:Zp2 UTSW 7 119,737,541 (GRCm39) missense probably benign 0.01
R4863:Zp2 UTSW 7 119,734,995 (GRCm39) missense probably damaging 1.00
R5274:Zp2 UTSW 7 119,737,315 (GRCm39) missense possibly damaging 0.92
R5392:Zp2 UTSW 7 119,734,987 (GRCm39) nonsense probably null
R5877:Zp2 UTSW 7 119,732,562 (GRCm39) missense probably null 0.94
R6390:Zp2 UTSW 7 119,740,453 (GRCm39) missense probably benign 0.23
R6404:Zp2 UTSW 7 119,734,765 (GRCm39) missense possibly damaging 0.73
R6546:Zp2 UTSW 7 119,731,748 (GRCm39) missense probably benign 0.00
R6622:Zp2 UTSW 7 119,731,748 (GRCm39) missense probably benign 0.00
R6707:Zp2 UTSW 7 119,733,145 (GRCm39) missense possibly damaging 0.85
R7274:Zp2 UTSW 7 119,731,614 (GRCm39) makesense probably null
R7275:Zp2 UTSW 7 119,734,576 (GRCm39) splice site probably null
R7541:Zp2 UTSW 7 119,735,279 (GRCm39) missense probably damaging 1.00
R7585:Zp2 UTSW 7 119,733,167 (GRCm39) missense probably damaging 1.00
R7709:Zp2 UTSW 7 119,734,998 (GRCm39) missense probably damaging 1.00
R7742:Zp2 UTSW 7 119,731,731 (GRCm39) missense unknown
R7767:Zp2 UTSW 7 119,736,392 (GRCm39) missense probably benign 0.01
R7771:Zp2 UTSW 7 119,742,865 (GRCm39) missense probably damaging 0.96
R8391:Zp2 UTSW 7 119,726,179 (GRCm39) missense probably benign 0.00
R8872:Zp2 UTSW 7 119,733,025 (GRCm39) missense probably benign 0.14
R8880:Zp2 UTSW 7 119,742,835 (GRCm39) missense possibly damaging 0.80
R9673:Zp2 UTSW 7 119,733,238 (GRCm39) missense probably damaging 1.00
X0017:Zp2 UTSW 7 119,732,608 (GRCm39) missense probably damaging 1.00
X0023:Zp2 UTSW 7 119,732,590 (GRCm39) missense probably damaging 1.00
Z1176:Zp2 UTSW 7 119,734,402 (GRCm39) missense not run
Z1177:Zp2 UTSW 7 119,734,432 (GRCm39) missense probably damaging 1.00
Z1177:Zp2 UTSW 7 119,734,402 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- CTGCTAAGCCCAGCTATGTC -3'
(R):5'- AGAGTTAGCTATAGCCTCCTGG -3'

Sequencing Primer
(F):5'- TGCTAAGCCCAGCTATGTCTACAAC -3'
(R):5'- GAACTGGTACTGCTGAACTCCAATG -3'
Posted On 2018-06-22