Incidental Mutation 'R6589:Hdac9'
ID524528
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6589 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34215029 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 908 (E908G)
Ref Sequence ENSEMBL: ENSMUSP00000148224 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000209750
AA Change: E887G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000209902
AA Change: E884G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209990
AA Change: E843G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000210724
AA Change: E797G
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: E908G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7677 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 G A 13: 112,348,863 probably null Het
Asic2 G T 11: 80,886,604 A427D possibly damaging Het
B3gnt2 T A 11: 22,837,117 I24F probably damaging Het
BC030500 T C 8: 58,912,922 probably benign Het
Cdh4 G A 2: 179,881,996 probably null Het
Cramp1l T C 17: 24,977,492 probably null Het
Fam19a2 T A 10: 123,704,392 V51E probably damaging Het
Fam72a A T 1: 131,533,816 I80F probably damaging Het
Fbxo43 T C 15: 36,162,540 T174A probably damaging Het
Fgf11 C A 11: 69,799,435 V109L probably damaging Het
Fggy A G 4: 95,597,638 I74V probably benign Het
Fshr T C 17: 88,988,607 D224G probably damaging Het
Gm5415 A T 1: 32,546,711 D39E probably benign Het
Gm6465 A G 5: 11,848,161 T81A possibly damaging Het
Gm9268 T A 7: 43,023,598 S142T possibly damaging Het
Hspa4l T G 3: 40,757,055 L121V probably damaging Het
Klk1b16 A G 7: 44,141,470 D232G probably benign Het
Lpl G T 8: 68,896,807 M328I probably benign Het
Mgat4a T C 1: 37,444,895 E498G probably damaging Het
Mup11 T A 4: 60,659,541 Q91L possibly damaging Het
Myoc T A 1: 162,648,619 Y297* probably null Het
Olfr126 T A 17: 37,850,836 Y81* probably null Het
Siva1 A G 12: 112,646,838 E40G probably damaging Het
Smarca2 T A 19: 26,619,884 H55Q possibly damaging Het
Taf1b A G 12: 24,556,528 E449G possibly damaging Het
Tcaf3 A T 6: 42,594,061 N252K possibly damaging Het
Trim3 A G 7: 105,617,960 L404P probably damaging Het
Vmn2r114 T C 17: 23,291,668 T613A probably damaging Het
Zfp358 T A 8: 3,495,907 F163Y probably damaging Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAATATAGCCGTGTAAATGC -3'
(R):5'- AGTGCATAACCCAGAGCACTG -3'

Sequencing Primer
(F):5'- CCGTGTAAATGCAACTAGGTCTTG -3'
(R):5'- CAGAGCACTGGTTGTCAAGC -3'
Posted On2018-06-22