Incidental Mutation 'R6622:Man2b1'
ID 524529
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Name mannosidase 2, alpha B1
Synonyms lysosomal alpha-mannosidase
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 85809899-85824911 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85811108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000079764] [ENSMUST00000093357] [ENSMUST00000209361] [ENSMUST00000209264] [ENSMUST00000152785] [ENSMUST00000140621] [ENSMUST00000149050]
AlphaFold O09159
Predicted Effect probably damaging
Transcript: ENSMUST00000034121
AA Change: T80A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: T80A

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079764
SMART Domains Protein: ENSMUSP00000078697
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:UPF0139 85 183 6.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093357
SMART Domains Protein: ENSMUSP00000091048
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 98 137 8.1e-9 SMART
WD40 142 179 5.52e-2 SMART
WD40 182 219 1.66e0 SMART
WD40 222 263 7e-4 SMART
WD40 266 304 4.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136696
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Predicted Effect probably benign
Transcript: ENSMUST00000209264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152186
Predicted Effect probably benign
Transcript: ENSMUST00000152785
SMART Domains Protein: ENSMUSP00000122127
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 140 177 5.52e-2 SMART
WD40 180 217 1.66e0 SMART
WD40 220 261 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211379
Predicted Effect probably benign
Transcript: ENSMUST00000140621
SMART Domains Protein: ENSMUSP00000117962
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
Pfam:UPF0139 5 88 1.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149050
SMART Domains Protein: ENSMUSP00000121568
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211223
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85,811,267 (GRCm39) splice site probably null
IGL00671:Man2b1 APN 8 85,820,567 (GRCm39) missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85,824,059 (GRCm39) missense probably benign 0.00
dateline UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
greenwich UTSW 8 85,812,085 (GRCm39) nonsense probably null
longitude UTSW 8 85,821,773 (GRCm39) nonsense probably null
meridian UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85,824,118 (GRCm39) missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85,819,645 (GRCm39) missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85,823,405 (GRCm39) missense probably benign
R0727:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85,823,458 (GRCm39) missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85,821,800 (GRCm39) missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85,813,474 (GRCm39) missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85,820,563 (GRCm39) missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85,813,451 (GRCm39) missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85,821,964 (GRCm39) missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85,812,013 (GRCm39) missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85,819,653 (GRCm39) splice site probably benign
R3897:Man2b1 UTSW 8 85,823,577 (GRCm39) splice site probably benign
R3971:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85,812,020 (GRCm39) missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85,811,366 (GRCm39) missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85,817,565 (GRCm39) missense probably benign 0.22
R5183:Man2b1 UTSW 8 85,822,413 (GRCm39) missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85,811,088 (GRCm39) missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85,820,839 (GRCm39) missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85,823,381 (GRCm39) missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85,823,675 (GRCm39) missense probably benign 0.44
R6341:Man2b1 UTSW 8 85,822,028 (GRCm39) missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85,824,076 (GRCm39) missense possibly damaging 0.91
R6624:Man2b1 UTSW 8 85,823,482 (GRCm39) missense probably benign 0.01
R6631:Man2b1 UTSW 8 85,813,440 (GRCm39) splice site probably null
R6828:Man2b1 UTSW 8 85,813,548 (GRCm39) missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85,817,700 (GRCm39) splice site probably null
R7159:Man2b1 UTSW 8 85,813,909 (GRCm39) missense probably benign 0.09
R7267:Man2b1 UTSW 8 85,813,804 (GRCm39) missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85,817,594 (GRCm39) nonsense probably null
R7786:Man2b1 UTSW 8 85,812,085 (GRCm39) nonsense probably null
R8022:Man2b1 UTSW 8 85,822,242 (GRCm39) missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85,823,674 (GRCm39) missense probably benign 0.03
R8251:Man2b1 UTSW 8 85,821,758 (GRCm39) missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85,822,907 (GRCm39) missense probably damaging 1.00
R8464:Man2b1 UTSW 8 85,820,772 (GRCm39) missense possibly damaging 0.55
R8701:Man2b1 UTSW 8 85,821,782 (GRCm39) missense probably damaging 1.00
R8792:Man2b1 UTSW 8 85,821,773 (GRCm39) nonsense probably null
R8891:Man2b1 UTSW 8 85,811,084 (GRCm39) missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85,822,022 (GRCm39) missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85,818,539 (GRCm39) missense probably benign 0.36
R9059:Man2b1 UTSW 8 85,818,155 (GRCm39) missense probably damaging 1.00
Z1176:Man2b1 UTSW 8 85,820,567 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCGTGTGAAAGTGGAAGTC -3'
(R):5'- CAGATGCGTGCTGAACATCAC -3'

Sequencing Primer
(F):5'- ACCTATGGTCTTGAACATGCCAGG -3'
(R):5'- TGCTGAACATCACTCAGGACTGTG -3'
Posted On 2018-06-22