Incidental Mutation 'R6622:Tmem231'
ID 524530
Institutional Source Beutler Lab
Gene Symbol Tmem231
Ensembl Gene ENSMUSG00000031951
Gene Name transmembrane protein 231
Synonyms 4932417I16Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 112638639-112660445 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112645563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000034429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034429] [ENSMUST00000211866]
AlphaFold Q3U284
Predicted Effect probably damaging
Transcript: ENSMUST00000034429
AA Change: D112G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034429
Gene: ENSMUSG00000031951
AA Change: D112G

DomainStartEndE-ValueType
Pfam:TM231 1 301 5.8e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211866
AA Change: M139V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete lethality throughout fetal growth and development, defective patterning of the ventral spinal cord, a striking loss in cilia, severe vascular defects, polydactyly, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Tmem231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tmem231 APN 8 112,645,072 (GRCm39) splice site probably benign
IGL02800:Tmem231 APN 8 112,640,664 (GRCm39) missense probably benign 0.03
R2281:Tmem231 UTSW 8 112,645,563 (GRCm39) missense probably damaging 1.00
R2306:Tmem231 UTSW 8 112,645,503 (GRCm39) missense probably damaging 1.00
R3615:Tmem231 UTSW 8 112,644,945 (GRCm39) missense possibly damaging 0.63
R3616:Tmem231 UTSW 8 112,644,945 (GRCm39) missense possibly damaging 0.63
R4541:Tmem231 UTSW 8 112,641,224 (GRCm39) missense probably benign 0.02
R4708:Tmem231 UTSW 8 112,660,418 (GRCm39) start gained probably benign
R5522:Tmem231 UTSW 8 112,645,042 (GRCm39) missense possibly damaging 0.92
R6266:Tmem231 UTSW 8 112,641,897 (GRCm39) missense probably null 0.71
R6414:Tmem231 UTSW 8 112,653,524 (GRCm39) intron probably benign
R6415:Tmem231 UTSW 8 112,653,524 (GRCm39) intron probably benign
R6418:Tmem231 UTSW 8 112,653,524 (GRCm39) intron probably benign
R6419:Tmem231 UTSW 8 112,653,524 (GRCm39) intron probably benign
R6938:Tmem231 UTSW 8 112,660,144 (GRCm39) missense probably damaging 0.97
R7103:Tmem231 UTSW 8 112,645,517 (GRCm39) splice site probably null
R7221:Tmem231 UTSW 8 112,660,308 (GRCm39) missense probably benign
R7305:Tmem231 UTSW 8 112,641,927 (GRCm39) missense possibly damaging 0.70
R7438:Tmem231 UTSW 8 112,645,040 (GRCm39) missense probably damaging 1.00
R7781:Tmem231 UTSW 8 112,644,922 (GRCm39) critical splice donor site probably null
R8951:Tmem231 UTSW 8 112,640,697 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGAAGAGCCATCTGCAGTGTG -3'
(R):5'- ACTGGCTCACTTTGTAGACC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CTCACTTTGTAGACCAGGCTGG -3'
Posted On 2018-06-22