Incidental Mutation 'R6622:Slc22a14'
ID 524542
Institutional Source Beutler Lab
Gene Symbol Slc22a14
Ensembl Gene ENSMUSG00000070280
Gene Name solute carrier family 22 (organic cation transporter), member 14
Synonyms LOC382113
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 118998521-119019496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 118999643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 516 (I516S)
Ref Sequence ENSEMBL: ENSMUSP00000131982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093775] [ENSMUST00000170400]
AlphaFold Q497L9
Predicted Effect possibly damaging
Transcript: ENSMUST00000093775
AA Change: I516S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091289
Gene: ENSMUSG00000070280
AA Change: I516S

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 156 556 1.3e-28 PFAM
Pfam:MFS_1 178 514 7.8e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152061
AA Change: I90S
SMART Domains Protein: ENSMUSP00000117967
Gene: ENSMUSG00000070280
AA Change: I90S

DomainStartEndE-ValueType
transmembrane domain 73 92 N/A INTRINSIC
transmembrane domain 99 118 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170400
AA Change: I516S

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280
AA Change: I516S

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Slc22a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Slc22a14 APN 9 119,007,579 (GRCm39) missense possibly damaging 0.58
R0086:Slc22a14 UTSW 9 119,051,804 (GRCm39) critical splice donor site probably benign
R0505:Slc22a14 UTSW 9 119,001,100 (GRCm39) splice site probably benign
R0593:Slc22a14 UTSW 9 118,998,919 (GRCm39) missense probably benign 0.15
R0597:Slc22a14 UTSW 9 119,001,190 (GRCm39) missense probably damaging 0.99
R0674:Slc22a14 UTSW 9 119,007,608 (GRCm39) missense probably damaging 1.00
R1290:Slc22a14 UTSW 9 119,007,518 (GRCm39) missense probably damaging 1.00
R1459:Slc22a14 UTSW 9 119,052,827 (GRCm39) missense possibly damaging 0.70
R1706:Slc22a14 UTSW 9 119,010,050 (GRCm39) missense probably benign 0.06
R3980:Slc22a14 UTSW 9 119,007,552 (GRCm39) missense probably benign 0.02
R4166:Slc22a14 UTSW 9 119,008,934 (GRCm39) missense possibly damaging 0.53
R4166:Slc22a14 UTSW 9 119,007,498 (GRCm39) missense probably benign 0.00
R4574:Slc22a14 UTSW 9 119,008,561 (GRCm39) missense probably damaging 0.99
R4959:Slc22a14 UTSW 9 119,003,101 (GRCm39) small deletion probably benign
R4973:Slc22a14 UTSW 9 119,003,101 (GRCm39) small deletion probably benign
R5273:Slc22a14 UTSW 9 118,999,704 (GRCm39) missense probably benign 0.08
R5330:Slc22a14 UTSW 9 119,059,662 (GRCm39) missense probably damaging 1.00
R5331:Slc22a14 UTSW 9 119,059,662 (GRCm39) missense probably damaging 1.00
R5543:Slc22a14 UTSW 9 119,002,674 (GRCm39) missense probably benign 0.01
R5801:Slc22a14 UTSW 9 119,001,149 (GRCm39) missense probably benign 0.01
R6521:Slc22a14 UTSW 9 119,049,835 (GRCm39) splice site probably null
R6948:Slc22a14 UTSW 9 119,060,482 (GRCm39) missense probably damaging 1.00
R7027:Slc22a14 UTSW 9 119,060,281 (GRCm39) splice site probably null
R7731:Slc22a14 UTSW 9 118,999,677 (GRCm39) missense possibly damaging 0.95
R7985:Slc22a14 UTSW 9 118,999,704 (GRCm39) missense probably benign 0.01
R8412:Slc22a14 UTSW 9 119,009,922 (GRCm39) missense probably benign 0.00
R8508:Slc22a14 UTSW 9 119,009,651 (GRCm39) missense probably damaging 1.00
R8674:Slc22a14 UTSW 9 119,007,467 (GRCm39) missense probably null 1.00
R8773:Slc22a14 UTSW 9 119,059,290 (GRCm39) intron probably benign
R8950:Slc22a14 UTSW 9 118,998,778 (GRCm39) missense possibly damaging 0.71
R9484:Slc22a14 UTSW 9 119,009,615 (GRCm39) missense probably damaging 1.00
R9633:Slc22a14 UTSW 9 119,008,528 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGGACAGTATCTGACACAC -3'
(R):5'- ACTAGGTTGGAGAACTGGGTTC -3'

Sequencing Primer
(F):5'- CTCTATTCCCAGAGCTTGAGACAAGG -3'
(R):5'- CTGGGTTCTCTAAGGTCAAACACTG -3'
Posted On 2018-06-22