Incidental Mutation 'R6622:Rnf126'
ID 524544
Institutional Source Beutler Lab
Gene Symbol Rnf126
Ensembl Gene ENSMUSG00000035890
Gene Name ring finger protein 126
Synonyms 2610010O19Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.739) question?
Stock # R6622 (G1)
Quality Score 149.008
Status Not validated
Chromosome 10
Chromosomal Location 79594349-79602786 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 79597397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020577] [ENSMUST00000047203] [ENSMUST00000219228] [ENSMUST00000219981]
AlphaFold Q91YL2
PDB Structure Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of RING finger protein 126 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020577
SMART Domains Protein: ENSMUSP00000020577
Gene: ENSMUSG00000020327

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 30 159 1.73e-62 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047203
SMART Domains Protein: ENSMUSP00000039486
Gene: ENSMUSG00000035890

DomainStartEndE-ValueType
Pfam:zinc_ribbon_9 9 40 5e-11 PFAM
low complexity region 109 121 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RING 231 271 5.68e-9 SMART
low complexity region 293 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219189
Predicted Effect probably benign
Transcript: ENSMUST00000219228
Predicted Effect probably benign
Transcript: ENSMUST00000219981
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Rnf126
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Rnf126 UTSW 10 79,596,726 (GRCm39) missense probably damaging 1.00
BB017:Rnf126 UTSW 10 79,596,726 (GRCm39) missense probably damaging 1.00
R0087:Rnf126 UTSW 10 79,595,068 (GRCm39) missense probably damaging 0.97
R0302:Rnf126 UTSW 10 79,595,057 (GRCm39) missense probably damaging 1.00
R0418:Rnf126 UTSW 10 79,598,477 (GRCm39) unclassified probably benign
R0671:Rnf126 UTSW 10 79,597,441 (GRCm39) missense possibly damaging 0.83
R1403:Rnf126 UTSW 10 79,596,702 (GRCm39) missense probably benign 0.00
R1449:Rnf126 UTSW 10 79,597,448 (GRCm39) missense probably benign 0.31
R2058:Rnf126 UTSW 10 79,594,971 (GRCm39) unclassified probably benign
R3153:Rnf126 UTSW 10 79,597,465 (GRCm39) missense probably damaging 1.00
R3154:Rnf126 UTSW 10 79,597,465 (GRCm39) missense probably damaging 1.00
R5535:Rnf126 UTSW 10 79,598,533 (GRCm39) missense probably damaging 1.00
R5815:Rnf126 UTSW 10 79,602,603 (GRCm39) missense probably benign 0.03
R6748:Rnf126 UTSW 10 79,597,970 (GRCm39) missense probably benign 0.00
R7930:Rnf126 UTSW 10 79,596,726 (GRCm39) missense probably damaging 1.00
R9439:Rnf126 UTSW 10 79,597,465 (GRCm39) missense probably damaging 1.00
RF022:Rnf126 UTSW 10 79,594,977 (GRCm39) frame shift probably null
RF023:Rnf126 UTSW 10 79,594,977 (GRCm39) frame shift probably null
RF056:Rnf126 UTSW 10 79,594,976 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTACTAGGCCAGCCTCTCG -3'
(R):5'- ACCATTGGTAGAAGAGCACG -3'

Sequencing Primer
(F):5'- TAGTCCATTGGGTTCGAG -3'
(R):5'- CCAGTGGAAGGTCAGCTTG -3'
Posted On 2018-06-22