Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Fxr2'

524548

Institutional Source

Beutler Lab

Gene Symbol

Fxr2

Ensembl Gene

ENSMUSG00000018765

Gene Name

fragile X mental retardation, autosomal homolog 2

Synonyms

Fxr2h

Accession Numbers

Essential gene?

Probably essential (E-score: 0.784) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69632990-69653297 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 69641590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000018909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018909]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000018909

SMART Domains

Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765

Domain	Start	End	E-Value	Type
Pfam:Agenet	72	130	1.3e-10	PFAM
KH	227	294	3.06e-3	SMART
KH	295	366	4.16e-5	SMART
low complexity region	368	380	N/A	INTRINSIC
low complexity region	389	406	N/A	INTRINSIC
low complexity region	423	442	N/A	INTRINSIC
low complexity region	475	503	N/A	INTRINSIC
Pfam:FXR_C1	504	579	2.5e-36	PFAM
low complexity region	586	599	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139605

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155513

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, impaired Morris water task performance, and reductions in prepulse inhibition, contextual conditioned fear, and sensitivity to heat stimulus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Fxr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00469:Fxr2	APN	11	69642139	missense	possibly damaging	0.77
IGL00595:Fxr2	APN	11	69649192	missense	probably benign	0.01
IGL00659:Fxr2	APN	11	69640250	missense	probably benign	0.12
IGL00921:Fxr2	APN	11	69652240	missense	probably damaging	1.00
IGL01025:Fxr2	APN	11	69643887	missense	probably damaging	1.00
IGL01154:Fxr2	APN	11	69641433	splice site	probably benign
IGL01347:Fxr2	APN	11	69652288	missense	probably benign	0.27
IGL01743:Fxr2	APN	11	69652622	missense	possibly damaging	0.53
IGL01981:Fxr2	APN	11	69650502	missense	possibly damaging	0.95
IGL02332:Fxr2	APN	11	69649838	critical splice donor site	probably null
IGL02385:Fxr2	APN	11	69652269	missense	possibly damaging	0.82
IGL03172:Fxr2	APN	11	69649839	critical splice donor site	probably null
R0092:Fxr2	UTSW	11	69642146	splice site	probably benign
R0720:Fxr2	UTSW	11	69639415	missense	probably benign	0.03
R1112:Fxr2	UTSW	11	69652248	missense	probably damaging	1.00
R1344:Fxr2	UTSW	11	69648884	missense	possibly damaging	0.68
R1635:Fxr2	UTSW	11	69641313	missense	possibly damaging	0.77
R1864:Fxr2	UTSW	11	69652277	missense	probably benign	0.30
R1957:Fxr2	UTSW	11	69643940	missense	probably benign	0.03
R1992:Fxr2	UTSW	11	69649833	missense	possibly damaging	0.92
R2243:Fxr2	UTSW	11	69642070	missense	possibly damaging	0.93
R2863:Fxr2	UTSW	11	69639427	missense	probably damaging	1.00
R2865:Fxr2	UTSW	11	69639427	missense	probably damaging	1.00
R5255:Fxr2	UTSW	11	69643841	missense	probably benign	0.03
R5726:Fxr2	UTSW	11	69633346	missense	probably benign	0.00
R5899:Fxr2	UTSW	11	69652685	missense	probably damaging	1.00
R6045:Fxr2	UTSW	11	69651051	missense	possibly damaging	0.90
R6146:Fxr2	UTSW	11	69641339	missense	possibly damaging	0.82
R6149:Fxr2	UTSW	11	69649204	missense	probably benign	0.05
R6195:Fxr2	UTSW	11	69652273	missense	probably benign	0.30
R7381:Fxr2	UTSW	11	69642049	missense	possibly damaging	0.89
R7382:Fxr2	UTSW	11	69641556	missense	probably benign	0.03
R9599:Fxr2	UTSW	11	69652643	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGGAATTCCTGAGACTGTTC -3'
(R):5'- CCAGAGAGGTAGAACCCCTG -3'

Sequencing Primer
(F):5'- AGACTGTTCTTTTGTTCCTGAAAAGG -3'
(R):5'- CTCTGTGACTGCAAAGCAAGTCTG -3'

Posted On

2018-06-22