Incidental Mutation 'R6622:Cbx2'
ID524552
Institutional Source Beutler Lab
Gene Symbol Cbx2
Ensembl Gene ENSMUSG00000025577
Gene Namechromobox 2
SynonymsM33
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6622 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119022962-119031270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119029135 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 509 (T509A)
Ref Sequence ENSEMBL: ENSMUSP00000026662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026662]
Predicted Effect probably damaging
Transcript: ENSMUST00000026662
AA Change: T509A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026662
Gene: ENSMUSG00000025577
AA Change: T509A

DomainStartEndE-ValueType
CHROMO 11 63 5.74e-17 SMART
AT_hook 74 86 2.05e-1 SMART
low complexity region 102 132 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 301 318 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139746
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in results in male-to-female gonadal sex reversal. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations cause malformations of the axial skeletal, reduced viability, poor growth and male to female sex reversal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,244,222 A2563D probably damaging Het
6030419C18Rik A G 9: 58,499,250 I148V probably benign Het
Adgrl3 A C 5: 81,794,759 D1412A probably benign Het
Arhgap26 A G 18: 38,899,863 probably benign Het
Card14 A G 11: 119,333,988 M614V probably benign Het
Cep135 A G 5: 76,640,968 D1136G probably benign Het
Cep170 T A 1: 176,756,332 Q827L probably damaging Het
Clock A T 5: 76,241,954 I349K probably damaging Het
Cnppd1 A T 1: 75,136,895 V243E probably damaging Het
Cops3 A G 11: 59,833,134 F93L probably damaging Het
Cxxc5 T G 18: 35,859,319 C258G possibly damaging Het
Cycs G A 6: 50,566,463 probably benign Het
Cyp2c40 A T 19: 39,802,546 H280Q probably damaging Het
Cyp4f14 C T 17: 32,914,645 R79H probably benign Het
Dnajc27 A G 12: 4,103,114 S197G probably benign Het
Dscam C T 16: 96,645,073 G1456E probably benign Het
Dst G A 1: 34,179,251 V1591I probably benign Het
Epha5 A G 5: 84,237,528 S315P possibly damaging Het
Fam46a G T 9: 85,326,456 R105S probably damaging Het
Frmd4a A G 2: 4,606,062 T1012A probably benign Het
Fxr2 G A 11: 69,641,590 probably null Het
Gm12394 T A 4: 42,793,111 L340F probably damaging Het
Hcn4 T A 9: 58,857,727 V534E unknown Het
Hrh4 A G 18: 13,022,397 Y331C probably damaging Het
Kif16b T A 2: 142,712,442 H812L probably benign Het
Krt14 T A 11: 100,203,960 R451S probably benign Het
Man2b1 A G 8: 85,084,479 T80A probably damaging Het
Nedd4l A G 18: 65,174,234 T383A probably damaging Het
Pcdha9 T A 18: 36,998,654 L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 C131R probably damaging Het
Prrc2a C G 17: 35,155,420 R1418P probably damaging Het
Ptpa G T 2: 30,437,577 E114D probably damaging Het
Ptprt A T 2: 161,553,840 C1157S probably damaging Het
Rnf126 A T 10: 79,761,563 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sel1l3 A G 5: 53,139,860 V748A probably damaging Het
Serinc5 T A 13: 92,688,686 S208T probably benign Het
Sftpb A G 6: 72,305,655 I74V possibly damaging Het
Slc22a14 A C 9: 119,170,577 I516S possibly damaging Het
Slco2a1 G A 9: 103,074,505 C411Y possibly damaging Het
Tet3 G A 6: 83,403,444 P581S probably benign Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Tnrc6b T A 15: 80,879,184 W296R probably damaging Het
Trpm1 T A 7: 64,240,595 L982H probably damaging Het
Ttn C A 2: 76,720,518 R23183I possibly damaging Het
Tuft1 T A 3: 94,635,419 Y46F probably damaging Het
Vmn1r167 T A 7: 23,505,589 M1L probably null Het
Zfp808 A G 13: 62,171,832 R292G possibly damaging Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Zp2 C T 7: 120,141,913 M129I probably benign Het
Other mutations in Cbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1005:Cbx2 UTSW 11 119028574 missense probably benign
R1629:Cbx2 UTSW 11 119028980 missense probably damaging 0.99
R1954:Cbx2 UTSW 11 119028340 missense probably damaging 0.99
R1962:Cbx2 UTSW 11 119028569 missense possibly damaging 0.76
R4674:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R4675:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R5558:Cbx2 UTSW 11 119028949 missense probably benign 0.01
R6446:Cbx2 UTSW 11 119027926 missense probably benign 0.08
R6550:Cbx2 UTSW 11 119029025 missense possibly damaging 0.63
R6610:Cbx2 UTSW 11 119024210 missense probably damaging 1.00
R7095:Cbx2 UTSW 11 119028059 missense probably damaging 1.00
R7132:Cbx2 UTSW 11 119023121 missense probably benign 0.08
R7478:Cbx2 UTSW 11 119029115 missense probably damaging 1.00
R8296:Cbx2 UTSW 11 119028128 missense probably damaging 1.00
R8374:Cbx2 UTSW 11 119028143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATAGTAGCTCTGACTCGGAC -3'
(R):5'- TTTTAAGTCAGTGGCCACCCG -3'

Sequencing Primer
(F):5'- TAGCTCTGACTCGGACCCTGAC -3'
(R):5'- CGGCTTTCCTGAGATGACAG -3'
Posted On2018-06-22