Incidental Mutation 'R6622:Dnajc27'
ID 524556
Institutional Source Beutler Lab
Gene Symbol Dnajc27
Ensembl Gene ENSMUSG00000020657
Gene Name DnaJ heat shock protein family (Hsp40) member C27
Synonyms C330021A05Rik, Rbj, Rabj
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4132583-4160606 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4153114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 197 (S197G)
Ref Sequence ENSEMBL: ENSMUSP00000151848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020986] [ENSMUST00000049584] [ENSMUST00000219923]
AlphaFold Q8CFP6
Predicted Effect probably benign
Transcript: ENSMUST00000020986
AA Change: S197G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020986
Gene: ENSMUSG00000020657
AA Change: S197G

DomainStartEndE-ValueType
Pfam:Arf 4 182 1.4e-15 PFAM
Pfam:GTP_EFTU 15 184 1.1e-5 PFAM
Pfam:Miro 18 137 6.6e-17 PFAM
Pfam:Ras 18 184 8e-44 PFAM
DnaJ 216 273 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049584
AA Change: S197G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106803
Gene: ENSMUSG00000020657
AA Change: S197G

DomainStartEndE-ValueType
Pfam:Arf 4 182 1.4e-15 PFAM
Pfam:MMR_HSR1 18 135 5.9e-6 PFAM
Pfam:Roc 18 138 2.1e-24 PFAM
Pfam:Ras 18 184 9.5e-44 PFAM
Pfam:Gtr1_RagA 18 185 4.5e-6 PFAM
DnaJ 216 273 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219923
AA Change: S197G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased incidence, multiplicity and tumor burden in an AOM/DSS-induced colonic carcinogenesis model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Dnajc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02338:Dnajc27 APN 12 4,146,229 (GRCm39) missense probably damaging 1.00
IGL02888:Dnajc27 APN 12 4,139,186 (GRCm39) missense possibly damaging 0.47
R0101:Dnajc27 UTSW 12 4,139,142 (GRCm39) missense probably benign 0.05
R0304:Dnajc27 UTSW 12 4,156,793 (GRCm39) splice site probably benign
R2005:Dnajc27 UTSW 12 4,147,317 (GRCm39) missense possibly damaging 0.83
R2912:Dnajc27 UTSW 12 4,146,280 (GRCm39) missense probably damaging 0.98
R6824:Dnajc27 UTSW 12 4,156,897 (GRCm39) missense possibly damaging 0.80
R7354:Dnajc27 UTSW 12 4,146,249 (GRCm39) missense probably benign
R7664:Dnajc27 UTSW 12 4,153,132 (GRCm39) missense possibly damaging 0.81
R7953:Dnajc27 UTSW 12 4,147,270 (GRCm39) missense possibly damaging 0.73
R8679:Dnajc27 UTSW 12 4,146,325 (GRCm39) missense possibly damaging 0.81
R9287:Dnajc27 UTSW 12 4,146,256 (GRCm39) missense possibly damaging 0.87
X0028:Dnajc27 UTSW 12 4,153,130 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTATTACCAACTTCAACTGTGG -3'
(R):5'- TGGGGCAGAGTCCTTATGAG -3'

Sequencing Primer
(F):5'- GGGGGCGATATATATAGTTCCAATCC -3'
(R):5'- GTCTTCAAGTTCCTAGGCAATCAG -3'
Posted On 2018-06-22