Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Zfp808'

524558

Institutional Source

Beutler Lab

Gene Symbol

Zfp808

Ensembl Gene

ENSMUSG00000074867

Gene Name

zinc finger protein 808

Synonyms

Gm7036

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R6622 (G1)

Quality Score

191.009

Status

Not validated

Chromosome

Chromosomal Location

62129886-62236144 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62171832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 292 (R292G)

Ref Sequence

ENSEMBL: ENSMUSP00000097048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]

AlphaFold

B8JJZ4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099449
AA Change: R292G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: R292G

Domain	Start	End	E-Value	Type
KRAB	4	66	2.1e-17	SMART
ZnF_C2H2	133	155	2.4e-3	SMART
ZnF_C2H2	161	183	8.34e-3	SMART
ZnF_C2H2	189	211	2.75e-3	SMART
ZnF_C2H2	217	239	1.98e-4	SMART
ZnF_C2H2	245	267	3.21e-4	SMART
ZnF_C2H2	273	295	2.43e-4	SMART
ZnF_C2H2	301	323	8.6e-5	SMART
ZnF_C2H2	329	351	4.54e-4	SMART
ZnF_C2H2	357	379	9.22e-5	SMART
ZnF_C2H2	385	407	8.22e-2	SMART
ZnF_C2H2	413	435	1.56e-2	SMART
ZnF_C2H2	441	463	5.99e-4	SMART
ZnF_C2H2	469	491	2.79e-4	SMART
ZnF_C2H2	497	519	4.54e-4	SMART
ZnF_C2H2	525	547	1.95e-3	SMART
ZnF_C2H2	553	575	4.24e-4	SMART
ZnF_C2H2	581	603	2.27e-4	SMART
ZnF_C2H2	609	631	2.27e-4	SMART
ZnF_C2H2	637	659	9.08e-4	SMART
ZnF_C2H2	665	687	1.4e-4	SMART
ZnF_C2H2	693	715	4.24e-4	SMART
ZnF_C2H2	721	743	1.26e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221542

Predicted Effect

probably benign
Transcript: ENSMUST00000221772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222947

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223094

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Zfp808

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01609:Zfp808	APN	13	62173209	missense	probably damaging	0.96
IGL02517:Zfp808	APN	13	62173218	makesense	probably null
IGL02809:Zfp808	APN	13	62173180	missense	probably benign	0.00
IGL02882:Zfp808	APN	13	62173180	missense	probably benign	0.00
IGL02941:Zfp808	APN	13	62173130	missense	possibly damaging	0.82
IGL03184:Zfp808	APN	13	62169567	missense	possibly damaging	0.90
LCD18:Zfp808	UTSW	13	62166651	intron	probably benign
R0387:Zfp808	UTSW	13	62169478	missense	probably damaging	1.00
R0472:Zfp808	UTSW	13	62172306	missense	probably damaging	1.00
R0544:Zfp808	UTSW	13	62169434	splice site	probably benign
R0635:Zfp808	UTSW	13	62172419	missense	probably damaging	1.00
R0981:Zfp808	UTSW	13	62171673	missense	possibly damaging	0.47
R1446:Zfp808	UTSW	13	62173007	missense	probably damaging	1.00
R1569:Zfp808	UTSW	13	62172900	nonsense	probably null
R1573:Zfp808	UTSW	13	62171497	missense	possibly damaging	0.52
R1761:Zfp808	UTSW	13	62171646	missense	possibly damaging	0.71
R1796:Zfp808	UTSW	13	62171856	missense	probably damaging	1.00
R1993:Zfp808	UTSW	13	62172907	missense	probably benign	0.10
R2656:Zfp808	UTSW	13	62172852	missense	possibly damaging	0.63
R2938:Zfp808	UTSW	13	62171218	missense	probably benign
R3027:Zfp808	UTSW	13	62171590	missense	probably benign	0.33
R3777:Zfp808	UTSW	13	62171903	missense	probably damaging	0.97
R3779:Zfp808	UTSW	13	62171903	missense	probably damaging	0.97
R3801:Zfp808	UTSW	13	62172083	missense	probably damaging	1.00
R3802:Zfp808	UTSW	13	62172083	missense	probably damaging	1.00
R3804:Zfp808	UTSW	13	62172083	missense	probably damaging	1.00
R4024:Zfp808	UTSW	13	62171730	missense	possibly damaging	0.71
R4741:Zfp808	UTSW	13	62171949	missense	probably damaging	1.00
R4791:Zfp808	UTSW	13	62171231	missense	probably damaging	0.97
R4809:Zfp808	UTSW	13	62171292	nonsense	probably null
R4907:Zfp808	UTSW	13	62171473	missense	possibly damaging	0.71
R5056:Zfp808	UTSW	13	62172630	missense	probably damaging	1.00
R5760:Zfp808	UTSW	13	62171926	missense	probably damaging	1.00
R5869:Zfp808	UTSW	13	62171255	missense	probably damaging	1.00
R6230:Zfp808	UTSW	13	62172322	missense	probably benign	0.19
R6372:Zfp808	UTSW	13	62172477	missense	probably damaging	1.00
R6545:Zfp808	UTSW	13	62171895	missense	probably benign	0.02
R6620:Zfp808	UTSW	13	62172824	missense	probably benign	0.08
R6813:Zfp808	UTSW	13	62173035	missense	probably damaging	0.99
R6920:Zfp808	UTSW	13	62173168	missense	probably benign	0.05
R7511:Zfp808	UTSW	13	62172823	missense	probably benign
R7666:Zfp808	UTSW	13	62171411	missense	probably benign
R7747:Zfp808	UTSW	13	62171505	missense	probably benign	0.39
R7763:Zfp808	UTSW	13	62172664	missense	probably benign	0.28
R7779:Zfp808	UTSW	13	62172757	missense	possibly damaging	0.68
R8147:Zfp808	UTSW	13	62173120	missense	probably damaging	1.00
R8182:Zfp808	UTSW	13	62171707	missense	probably damaging	0.96
R8260:Zfp808	UTSW	13	62172738	missense	probably benign	0.01
R8434:Zfp808	UTSW	13	62172112	missense	probably damaging	1.00
R8822:Zfp808	UTSW	13	62173055	missense	probably damaging	1.00
R9330:Zfp808	UTSW	13	62172160	missense	probably benign	0.00
R9564:Zfp808	UTSW	13	62172847	missense	possibly damaging	0.49
RF005:Zfp808	UTSW	13	62171299	missense	probably benign	0.14
RF024:Zfp808	UTSW	13	62171299	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CCCTTCAAATGTAATCTGTGTGAT -3'
(R):5'- ACATTTGTAGGGTTTCTCTCCAGTA -3'

Sequencing Primer
(F):5'- GCCTTTTCTGAGAAATGTAATCTCC -3'
(R):5'- TGGAGACTACATTTCTCAGAAAAGGC -3'

Posted On

2018-06-22