Incidental Mutation 'R6622:Zfp808'
ID 524558
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Name zinc finger protein 808
Synonyms Gm7036
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6622 (G1)
Quality Score 191.009
Status Not validated
Chromosome 13
Chromosomal Location 62277674-62321752 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62319646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 292 (R292G)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
AlphaFold B8JJZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000099449
AA Change: R292G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: R292G

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221542
Predicted Effect probably benign
Transcript: ENSMUST00000221772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223094
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62,321,023 (GRCm39) missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62,321,032 (GRCm39) makesense probably null
IGL02809:Zfp808 APN 13 62,320,994 (GRCm39) missense probably benign 0.00
IGL02882:Zfp808 APN 13 62,320,994 (GRCm39) missense probably benign 0.00
IGL02941:Zfp808 APN 13 62,320,944 (GRCm39) missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62,317,381 (GRCm39) missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62,314,465 (GRCm39) intron probably benign
R0387:Zfp808 UTSW 13 62,317,292 (GRCm39) missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62,320,120 (GRCm39) missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62,317,248 (GRCm39) splice site probably benign
R0635:Zfp808 UTSW 13 62,320,233 (GRCm39) missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62,319,487 (GRCm39) missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62,320,821 (GRCm39) missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62,320,714 (GRCm39) nonsense probably null
R1573:Zfp808 UTSW 13 62,319,311 (GRCm39) missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62,319,460 (GRCm39) missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62,319,670 (GRCm39) missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62,320,721 (GRCm39) missense probably benign 0.10
R2656:Zfp808 UTSW 13 62,320,666 (GRCm39) missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62,319,032 (GRCm39) missense probably benign
R3027:Zfp808 UTSW 13 62,319,404 (GRCm39) missense probably benign 0.33
R3777:Zfp808 UTSW 13 62,319,717 (GRCm39) missense probably damaging 0.97
R3779:Zfp808 UTSW 13 62,319,717 (GRCm39) missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62,319,897 (GRCm39) missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62,319,897 (GRCm39) missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62,319,897 (GRCm39) missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62,319,544 (GRCm39) missense possibly damaging 0.71
R4741:Zfp808 UTSW 13 62,319,763 (GRCm39) missense probably damaging 1.00
R4791:Zfp808 UTSW 13 62,319,045 (GRCm39) missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62,319,106 (GRCm39) nonsense probably null
R4907:Zfp808 UTSW 13 62,319,287 (GRCm39) missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62,320,444 (GRCm39) missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62,319,740 (GRCm39) missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62,319,069 (GRCm39) missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62,320,136 (GRCm39) missense probably benign 0.19
R6372:Zfp808 UTSW 13 62,320,291 (GRCm39) missense probably damaging 1.00
R6545:Zfp808 UTSW 13 62,319,709 (GRCm39) missense probably benign 0.02
R6620:Zfp808 UTSW 13 62,320,638 (GRCm39) missense probably benign 0.08
R6813:Zfp808 UTSW 13 62,320,849 (GRCm39) missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62,320,982 (GRCm39) missense probably benign 0.05
R7511:Zfp808 UTSW 13 62,320,637 (GRCm39) missense probably benign
R7666:Zfp808 UTSW 13 62,319,225 (GRCm39) missense probably benign
R7747:Zfp808 UTSW 13 62,319,319 (GRCm39) missense probably benign 0.39
R7763:Zfp808 UTSW 13 62,320,478 (GRCm39) missense probably benign 0.28
R7779:Zfp808 UTSW 13 62,320,571 (GRCm39) missense possibly damaging 0.68
R8147:Zfp808 UTSW 13 62,320,934 (GRCm39) missense probably damaging 1.00
R8182:Zfp808 UTSW 13 62,319,521 (GRCm39) missense probably damaging 0.96
R8260:Zfp808 UTSW 13 62,320,552 (GRCm39) missense probably benign 0.01
R8434:Zfp808 UTSW 13 62,319,926 (GRCm39) missense probably damaging 1.00
R8822:Zfp808 UTSW 13 62,320,869 (GRCm39) missense probably damaging 1.00
R9330:Zfp808 UTSW 13 62,319,974 (GRCm39) missense probably benign 0.00
R9564:Zfp808 UTSW 13 62,320,661 (GRCm39) missense possibly damaging 0.49
RF005:Zfp808 UTSW 13 62,319,113 (GRCm39) missense probably benign 0.14
RF024:Zfp808 UTSW 13 62,319,113 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCCTTCAAATGTAATCTGTGTGAT -3'
(R):5'- ACATTTGTAGGGTTTCTCTCCAGTA -3'

Sequencing Primer
(F):5'- GCCTTTTCTGAGAAATGTAATCTCC -3'
(R):5'- TGGAGACTACATTTCTCAGAAAAGGC -3'
Posted On 2018-06-22