Incidental Mutation 'R6591:Rbm33'
ID524559
Institutional Source Beutler Lab
Gene Symbol Rbm33
Ensembl Gene ENSMUSG00000048271
Gene NameRNA binding motif protein 33
Synonyms6430512A10Rik, 3200001K10Rik, Prr8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6591 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location28317121-28419239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28352546 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 252 (E252D)
Ref Sequence ENSEMBL: ENSMUSP00000062449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030920] [ENSMUST00000059644] [ENSMUST00000090355] [ENSMUST00000114884]
Predicted Effect probably damaging
Transcript: ENSMUST00000030920
AA Change: E252D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030920
Gene: ENSMUSG00000048271
AA Change: E252D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059644
AA Change: E252D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062449
Gene: ENSMUSG00000048271
AA Change: E252D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
low complexity region 362 407 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
low complexity region 625 707 N/A INTRINSIC
low complexity region 817 837 N/A INTRINSIC
coiled coil region 846 891 N/A INTRINSIC
RRM 1160 1227 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090355
AA Change: E212D

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091512
Gene: ENSMUSG00000048271
AA Change: E212D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114884
AA Change: E212D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110534
Gene: ENSMUSG00000048271
AA Change: E212D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 267 287 N/A INTRINSIC
low complexity region 322 367 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
low complexity region 585 667 N/A INTRINSIC
low complexity region 777 797 N/A INTRINSIC
coiled coil region 806 851 N/A INTRINSIC
RRM 1120 1187 4.7e-6 SMART
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Rbm33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Rbm33 APN 5 28410709 missense probably damaging 0.98
IGL01470:Rbm33 APN 5 28387848 missense probably damaging 1.00
IGL01565:Rbm33 APN 5 28391079 unclassified probably benign
IGL02119:Rbm33 APN 5 28339017 missense probably damaging 1.00
IGL02740:Rbm33 APN 5 28331123 missense probably damaging 1.00
IGL02869:Rbm33 APN 5 28410755 missense probably damaging 0.99
IGL03355:Rbm33 APN 5 28391061 unclassified probably benign
IGL03381:Rbm33 APN 5 28394392 missense unknown
FR4449:Rbm33 UTSW 5 28394168 small deletion probably benign
FR4548:Rbm33 UTSW 5 28394201 small deletion probably benign
R0091:Rbm33 UTSW 5 28352606 missense possibly damaging 0.94
R0725:Rbm33 UTSW 5 28394483 missense unknown
R1522:Rbm33 UTSW 5 28337004 missense probably damaging 1.00
R1918:Rbm33 UTSW 5 28387917 missense probably damaging 1.00
R2186:Rbm33 UTSW 5 28394230 missense unknown
R2448:Rbm33 UTSW 5 28342417 missense probably benign 0.01
R4151:Rbm33 UTSW 5 28387940 missense probably damaging 1.00
R4685:Rbm33 UTSW 5 28408282 unclassified probably benign
R4787:Rbm33 UTSW 5 28342437 splice site probably null
R4954:Rbm33 UTSW 5 28339276 missense probably damaging 1.00
R5013:Rbm33 UTSW 5 28342411 missense probably benign 0.05
R5141:Rbm33 UTSW 5 28352689 missense probably damaging 1.00
R5248:Rbm33 UTSW 5 28337052 critical splice donor site probably null
R5259:Rbm33 UTSW 5 28352774 splice site probably null
R5695:Rbm33 UTSW 5 28339012 missense probably damaging 1.00
R5790:Rbm33 UTSW 5 28339298 missense probably damaging 1.00
R6668:Rbm33 UTSW 5 28342500 missense probably benign 0.01
R6691:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6930:Rbm33 UTSW 5 28352506 missense probably benign 0.09
R6931:Rbm33 UTSW 5 28410745 missense probably damaging 1.00
R7034:Rbm33 UTSW 5 28394498 missense unknown
R7056:Rbm33 UTSW 5 28394003 unclassified probably benign
R7224:Rbm33 UTSW 5 28394324 missense
R7579:Rbm33 UTSW 5 28368266 missense probably damaging 1.00
R7839:Rbm33 UTSW 5 28368399 splice site probably null
R7961:Rbm33 UTSW 5 28394608 missense
R8009:Rbm33 UTSW 5 28394608 missense
R8051:Rbm33 UTSW 5 28352625 missense probably damaging 0.99
R8265:Rbm33 UTSW 5 28394324 missense
R8461:Rbm33 UTSW 5 28387972 missense probably damaging 1.00
R8734:Rbm33 UTSW 5 28352876 intron probably benign
R8975:Rbm33 UTSW 5 28361993 small deletion probably benign
RF011:Rbm33 UTSW 5 28394181 small deletion probably benign
RF026:Rbm33 UTSW 5 28394181 small deletion probably benign
RF047:Rbm33 UTSW 5 28394162 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTTCACATAGCCTTTTACCAG -3'
(R):5'- TGAGCATAGCACAACTGGGC -3'

Sequencing Primer
(F):5'- ACCAGGCACTTTGAGCTGTAC -3'
(R):5'- GCACCAGCCTCACTTATACCATG -3'
Posted On2018-06-22