Mutagenetix > Incidental Mutations

Incidental Mutation 'R6622:Tnrc6b'

524564

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80879184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 296 (W296R)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably damaging
Transcript: ENSMUST00000067689
AA Change: W296R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: W296R

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het
Zp2	T	C	7: 120,132,525	E669G	probably benign	Het
Zp2	C	T	7: 120,141,913	M129I	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGTAGACGGGTCTGACATGG -3'
(R):5'- AATGCCCCTTTTCTAGAAGTCC -3'

Sequencing Primer
(F):5'- CTGACATGGAAGAGTGGCCTTG -3'
(R):5'- CCCTTCTTGGACCAATGCTG -3'

Posted On

2018-06-22