Incidental Mutation 'R6622:Tnrc6b'
ID 524564
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80879184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 296 (W296R)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: W296R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: W296R

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,244,222 A2563D probably damaging Het
6030419C18Rik A G 9: 58,499,250 I148V probably benign Het
Adgrl3 A C 5: 81,794,759 D1412A probably benign Het
Arhgap26 A G 18: 38,899,863 probably benign Het
Card14 A G 11: 119,333,988 M614V probably benign Het
Cbx2 A G 11: 119,029,135 T509A probably damaging Het
Cep135 A G 5: 76,640,968 D1136G probably benign Het
Cep170 T A 1: 176,756,332 Q827L probably damaging Het
Clock A T 5: 76,241,954 I349K probably damaging Het
Cnppd1 A T 1: 75,136,895 V243E probably damaging Het
Cops3 A G 11: 59,833,134 F93L probably damaging Het
Cxxc5 T G 18: 35,859,319 C258G possibly damaging Het
Cycs G A 6: 50,566,463 probably benign Het
Cyp2c40 A T 19: 39,802,546 H280Q probably damaging Het
Cyp4f14 C T 17: 32,914,645 R79H probably benign Het
Dnajc27 A G 12: 4,103,114 S197G probably benign Het
Dscam C T 16: 96,645,073 G1456E probably benign Het
Dst G A 1: 34,179,251 V1591I probably benign Het
Epha5 A G 5: 84,237,528 S315P possibly damaging Het
Fam46a G T 9: 85,326,456 R105S probably damaging Het
Frmd4a A G 2: 4,606,062 T1012A probably benign Het
Fxr2 G A 11: 69,641,590 probably null Het
Gm12394 T A 4: 42,793,111 L340F probably damaging Het
Hcn4 T A 9: 58,857,727 V534E unknown Het
Hrh4 A G 18: 13,022,397 Y331C probably damaging Het
Kif16b T A 2: 142,712,442 H812L probably benign Het
Krt14 T A 11: 100,203,960 R451S probably benign Het
Man2b1 A G 8: 85,084,479 T80A probably damaging Het
Nedd4l A G 18: 65,174,234 T383A probably damaging Het
Pcdha9 T A 18: 36,998,654 L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 C131R probably damaging Het
Prrc2a C G 17: 35,155,420 R1418P probably damaging Het
Ptpa G T 2: 30,437,577 E114D probably damaging Het
Ptprt A T 2: 161,553,840 C1157S probably damaging Het
Rnf126 A T 10: 79,761,563 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sel1l3 A G 5: 53,139,860 V748A probably damaging Het
Serinc5 T A 13: 92,688,686 S208T probably benign Het
Sftpb A G 6: 72,305,655 I74V possibly damaging Het
Slc22a14 A C 9: 119,170,577 I516S possibly damaging Het
Slco2a1 G A 9: 103,074,505 C411Y possibly damaging Het
Tet3 G A 6: 83,403,444 P581S probably benign Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Trpm1 T A 7: 64,240,595 L982H probably damaging Het
Ttn C A 2: 76,720,518 R23183I possibly damaging Het
Tuft1 T A 3: 94,635,419 Y46F probably damaging Het
Vmn1r167 T A 7: 23,505,589 M1L probably null Het
Zfp808 A G 13: 62,171,832 R292G possibly damaging Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Zp2 C T 7: 120,141,913 M129I probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
R8872:Tnrc6b UTSW 15 80918089 missense probably benign 0.23
R9029:Tnrc6b UTSW 15 80878978 missense possibly damaging 0.83
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9240:Tnrc6b UTSW 15 80880061 missense probably damaging 0.98
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
R9539:Tnrc6b UTSW 15 80876343 missense probably damaging 0.99
R9646:Tnrc6b UTSW 15 80889065 missense possibly damaging 0.89
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGTAGACGGGTCTGACATGG -3'
(R):5'- AATGCCCCTTTTCTAGAAGTCC -3'

Sequencing Primer
(F):5'- CTGACATGGAAGAGTGGCCTTG -3'
(R):5'- CCCTTCTTGGACCAATGCTG -3'
Posted On 2018-06-22