Incidental Mutation 'R6622:Cyp2c40'
ID524581
Institutional Source Beutler Lab
Gene Symbol Cyp2c40
Ensembl Gene ENSMUSG00000025004
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 40
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6622 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39767071-39812814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39802546 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 280 (H280Q)
Ref Sequence ENSEMBL: ENSMUSP00000125217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160476] [ENSMUST00000162507] [ENSMUST00000162630]
Predicted Effect probably damaging
Transcript: ENSMUST00000160476
AA Change: H280Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125217
Gene: ENSMUSG00000025004
AA Change: H280Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 516 9.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162434
Predicted Effect probably benign
Transcript: ENSMUST00000162507
SMART Domains Protein: ENSMUSP00000124618
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 120 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162630
SMART Domains Protein: ENSMUSP00000123884
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 193 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163090
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,244,222 A2563D probably damaging Het
6030419C18Rik A G 9: 58,499,250 I148V probably benign Het
Adgrl3 A C 5: 81,794,759 D1412A probably benign Het
Arhgap26 A G 18: 38,899,863 probably benign Het
Card14 A G 11: 119,333,988 M614V probably benign Het
Cbx2 A G 11: 119,029,135 T509A probably damaging Het
Cep135 A G 5: 76,640,968 D1136G probably benign Het
Cep170 T A 1: 176,756,332 Q827L probably damaging Het
Clock A T 5: 76,241,954 I349K probably damaging Het
Cnppd1 A T 1: 75,136,895 V243E probably damaging Het
Cops3 A G 11: 59,833,134 F93L probably damaging Het
Cxxc5 T G 18: 35,859,319 C258G possibly damaging Het
Cycs G A 6: 50,566,463 probably benign Het
Cyp4f14 C T 17: 32,914,645 R79H probably benign Het
Dnajc27 A G 12: 4,103,114 S197G probably benign Het
Dscam C T 16: 96,645,073 G1456E probably benign Het
Dst G A 1: 34,179,251 V1591I probably benign Het
Epha5 A G 5: 84,237,528 S315P possibly damaging Het
Fam46a G T 9: 85,326,456 R105S probably damaging Het
Frmd4a A G 2: 4,606,062 T1012A probably benign Het
Fxr2 G A 11: 69,641,590 probably null Het
Gm12394 T A 4: 42,793,111 L340F probably damaging Het
Hcn4 T A 9: 58,857,727 V534E unknown Het
Hrh4 A G 18: 13,022,397 Y331C probably damaging Het
Kif16b T A 2: 142,712,442 H812L probably benign Het
Krt14 T A 11: 100,203,960 R451S probably benign Het
Man2b1 A G 8: 85,084,479 T80A probably damaging Het
Nedd4l A G 18: 65,174,234 T383A probably damaging Het
Pcdha9 T A 18: 36,998,654 L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 C131R probably damaging Het
Prrc2a C G 17: 35,155,420 R1418P probably damaging Het
Ptpa G T 2: 30,437,577 E114D probably damaging Het
Ptprt A T 2: 161,553,840 C1157S probably damaging Het
Rnf126 A T 10: 79,761,563 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sel1l3 A G 5: 53,139,860 V748A probably damaging Het
Serinc5 T A 13: 92,688,686 S208T probably benign Het
Sftpb A G 6: 72,305,655 I74V possibly damaging Het
Slc22a14 A C 9: 119,170,577 I516S possibly damaging Het
Slco2a1 G A 9: 103,074,505 C411Y possibly damaging Het
Tet3 G A 6: 83,403,444 P581S probably benign Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Tnrc6b T A 15: 80,879,184 W296R probably damaging Het
Trpm1 T A 7: 64,240,595 L982H probably damaging Het
Ttn C A 2: 76,720,518 R23183I possibly damaging Het
Tuft1 T A 3: 94,635,419 Y46F probably damaging Het
Vmn1r167 T A 7: 23,505,589 M1L probably null Het
Zfp808 A G 13: 62,171,832 R292G possibly damaging Het
Zp2 T C 7: 120,132,525 E669G probably benign Het
Zp2 C T 7: 120,141,913 M129I probably benign Het
Other mutations in Cyp2c40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Cyp2c40 APN 19 39812583 missense probably benign 0.17
IGL01660:Cyp2c40 APN 19 39786810 missense probably damaging 0.99
IGL01897:Cyp2c40 APN 19 39803773 nonsense probably null
IGL01926:Cyp2c40 APN 19 39802655 missense probably benign 0.25
IGL02078:Cyp2c40 APN 19 39767482 missense probably benign 0.01
IGL02259:Cyp2c40 APN 19 39803802 missense probably benign 0.00
IGL02716:Cyp2c40 APN 19 39807536 missense possibly damaging 0.49
R0269:Cyp2c40 UTSW 19 39773896 missense probably damaging 1.00
R0308:Cyp2c40 UTSW 19 39777988 missense probably damaging 1.00
R0309:Cyp2c40 UTSW 19 39778051 missense possibly damaging 0.51
R0441:Cyp2c40 UTSW 19 39807163 splice site probably benign
R1068:Cyp2c40 UTSW 19 39812581 missense possibly damaging 0.93
R1123:Cyp2c40 UTSW 19 39812677 missense probably benign 0.00
R1443:Cyp2c40 UTSW 19 39777971 missense possibly damaging 0.90
R1506:Cyp2c40 UTSW 19 39777999 missense probably damaging 0.96
R1567:Cyp2c40 UTSW 19 39803771 missense probably null 0.99
R1731:Cyp2c40 UTSW 19 39812689 missense probably damaging 1.00
R1774:Cyp2c40 UTSW 19 39786806 missense probably damaging 1.00
R1861:Cyp2c40 UTSW 19 39786875 missense probably benign 0.11
R1977:Cyp2c40 UTSW 19 39778041 missense probably damaging 1.00
R2022:Cyp2c40 UTSW 19 39812780 unclassified probably benign
R2063:Cyp2c40 UTSW 19 39786780 missense probably benign 0.01
R2359:Cyp2c40 UTSW 19 39777954 missense probably damaging 1.00
R2413:Cyp2c40 UTSW 19 39803887 nonsense probably null
R3685:Cyp2c40 UTSW 19 39786779 missense possibly damaging 0.95
R4080:Cyp2c40 UTSW 19 39802529 missense probably benign 0.01
R4614:Cyp2c40 UTSW 19 39803856 missense probably damaging 1.00
R4661:Cyp2c40 UTSW 19 39786846 missense probably benign 0.00
R4716:Cyp2c40 UTSW 19 39802661 splice site probably null
R4799:Cyp2c40 UTSW 19 39773849 missense probably damaging 1.00
R5133:Cyp2c40 UTSW 19 39807219 missense probably benign 0.02
R5191:Cyp2c40 UTSW 19 39802591 missense probably damaging 0.96
R5310:Cyp2c40 UTSW 19 39778030 missense probably damaging 1.00
R5455:Cyp2c40 UTSW 19 39803792 missense possibly damaging 0.75
R5619:Cyp2c40 UTSW 19 39803784 missense probably damaging 1.00
R5989:Cyp2c40 UTSW 19 39807580 missense probably benign 0.45
R6175:Cyp2c40 UTSW 19 39812560 missense probably benign 0.00
R6987:Cyp2c40 UTSW 19 39812767 unclassified probably benign
R7057:Cyp2c40 UTSW 19 39807619 missense probably damaging 1.00
R7485:Cyp2c40 UTSW 19 39807606 nonsense probably null
R7560:Cyp2c40 UTSW 19 39807214 missense possibly damaging 0.81
R7648:Cyp2c40 UTSW 19 39803845 makesense probably null
R7718:Cyp2c40 UTSW 19 39767338 missense probably benign 0.00
R7763:Cyp2c40 UTSW 19 39807168 missense possibly damaging 0.90
R7893:Cyp2c40 UTSW 19 39786848 missense probably damaging 0.99
R8094:Cyp2c40 UTSW 19 39802565 missense probably benign 0.17
R8094:Cyp2c40 UTSW 19 39802571 missense probably benign 0.00
R8264:Cyp2c40 UTSW 19 39807527 missense possibly damaging 0.95
R8287:Cyp2c40 UTSW 19 39767455 missense probably damaging 0.98
R8302:Cyp2c40 UTSW 19 39807622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATCACCCTGTTCCTCTCAG -3'
(R):5'- CACTCAAACGATATGTGAGTGTGG -3'

Sequencing Primer
(F):5'- TCTCAGCCATTCCCACACATG -3'
(R):5'- ACGATATGTGAGTGTGGAAATATTG -3'
Posted On2018-06-22