Incidental Mutation 'R6622:Cyp2c40'
ID 524581
Institutional Source Beutler Lab
Gene Symbol Cyp2c40
Ensembl Gene ENSMUSG00000025004
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 40
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39755517-39801258 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39790990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 280 (H280Q)
Ref Sequence ENSEMBL: ENSMUSP00000125217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160476] [ENSMUST00000162507] [ENSMUST00000162630]
AlphaFold P56657
Predicted Effect probably damaging
Transcript: ENSMUST00000160476
AA Change: H280Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125217
Gene: ENSMUSG00000025004
AA Change: H280Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 516 9.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162434
Predicted Effect probably benign
Transcript: ENSMUST00000162507
SMART Domains Protein: ENSMUSP00000124618
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 120 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162630
SMART Domains Protein: ENSMUSP00000123884
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 193 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163090
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Cep170 T A 1: 176,583,898 (GRCm39) Q827L probably damaging Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Cyp2c40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Cyp2c40 APN 19 39,801,027 (GRCm39) missense probably benign 0.17
IGL01660:Cyp2c40 APN 19 39,775,254 (GRCm39) missense probably damaging 0.99
IGL01897:Cyp2c40 APN 19 39,792,217 (GRCm39) nonsense probably null
IGL01926:Cyp2c40 APN 19 39,791,099 (GRCm39) missense probably benign 0.25
IGL02078:Cyp2c40 APN 19 39,755,926 (GRCm39) missense probably benign 0.01
IGL02259:Cyp2c40 APN 19 39,792,246 (GRCm39) missense probably benign 0.00
IGL02716:Cyp2c40 APN 19 39,795,980 (GRCm39) missense possibly damaging 0.49
cypriot UTSW 19 39,755,899 (GRCm39) missense probably damaging 0.98
R0269:Cyp2c40 UTSW 19 39,762,340 (GRCm39) missense probably damaging 1.00
R0308:Cyp2c40 UTSW 19 39,766,432 (GRCm39) missense probably damaging 1.00
R0309:Cyp2c40 UTSW 19 39,766,495 (GRCm39) missense possibly damaging 0.51
R0441:Cyp2c40 UTSW 19 39,795,607 (GRCm39) splice site probably benign
R1068:Cyp2c40 UTSW 19 39,801,025 (GRCm39) missense possibly damaging 0.93
R1123:Cyp2c40 UTSW 19 39,801,121 (GRCm39) missense probably benign 0.00
R1443:Cyp2c40 UTSW 19 39,766,415 (GRCm39) missense possibly damaging 0.90
R1506:Cyp2c40 UTSW 19 39,766,443 (GRCm39) missense probably damaging 0.96
R1567:Cyp2c40 UTSW 19 39,792,215 (GRCm39) missense probably null 0.99
R1731:Cyp2c40 UTSW 19 39,801,133 (GRCm39) missense probably damaging 1.00
R1774:Cyp2c40 UTSW 19 39,775,250 (GRCm39) missense probably damaging 1.00
R1861:Cyp2c40 UTSW 19 39,775,319 (GRCm39) missense probably benign 0.11
R1977:Cyp2c40 UTSW 19 39,766,485 (GRCm39) missense probably damaging 1.00
R2022:Cyp2c40 UTSW 19 39,801,224 (GRCm39) unclassified probably benign
R2063:Cyp2c40 UTSW 19 39,775,224 (GRCm39) missense probably benign 0.01
R2359:Cyp2c40 UTSW 19 39,766,398 (GRCm39) missense probably damaging 1.00
R2413:Cyp2c40 UTSW 19 39,792,331 (GRCm39) nonsense probably null
R3685:Cyp2c40 UTSW 19 39,775,223 (GRCm39) missense possibly damaging 0.95
R4080:Cyp2c40 UTSW 19 39,790,973 (GRCm39) missense probably benign 0.01
R4614:Cyp2c40 UTSW 19 39,792,300 (GRCm39) missense probably damaging 1.00
R4661:Cyp2c40 UTSW 19 39,775,290 (GRCm39) missense probably benign 0.00
R4716:Cyp2c40 UTSW 19 39,791,105 (GRCm39) splice site probably null
R4799:Cyp2c40 UTSW 19 39,762,293 (GRCm39) missense probably damaging 1.00
R5133:Cyp2c40 UTSW 19 39,795,663 (GRCm39) missense probably benign 0.02
R5191:Cyp2c40 UTSW 19 39,791,035 (GRCm39) missense probably damaging 0.96
R5310:Cyp2c40 UTSW 19 39,766,474 (GRCm39) missense probably damaging 1.00
R5455:Cyp2c40 UTSW 19 39,792,236 (GRCm39) missense possibly damaging 0.75
R5619:Cyp2c40 UTSW 19 39,792,228 (GRCm39) missense probably damaging 1.00
R5989:Cyp2c40 UTSW 19 39,796,024 (GRCm39) missense probably benign 0.45
R6175:Cyp2c40 UTSW 19 39,801,004 (GRCm39) missense probably benign 0.00
R6987:Cyp2c40 UTSW 19 39,801,211 (GRCm39) unclassified probably benign
R7057:Cyp2c40 UTSW 19 39,796,063 (GRCm39) missense probably damaging 1.00
R7485:Cyp2c40 UTSW 19 39,796,050 (GRCm39) nonsense probably null
R7560:Cyp2c40 UTSW 19 39,795,658 (GRCm39) missense possibly damaging 0.81
R7648:Cyp2c40 UTSW 19 39,792,289 (GRCm39) makesense probably null
R7718:Cyp2c40 UTSW 19 39,755,782 (GRCm39) missense probably benign 0.00
R7763:Cyp2c40 UTSW 19 39,795,612 (GRCm39) missense possibly damaging 0.90
R7893:Cyp2c40 UTSW 19 39,775,292 (GRCm39) missense probably damaging 0.99
R8094:Cyp2c40 UTSW 19 39,791,015 (GRCm39) missense probably benign 0.00
R8094:Cyp2c40 UTSW 19 39,791,009 (GRCm39) missense probably benign 0.17
R8264:Cyp2c40 UTSW 19 39,795,971 (GRCm39) missense possibly damaging 0.95
R8287:Cyp2c40 UTSW 19 39,755,899 (GRCm39) missense probably damaging 0.98
R8302:Cyp2c40 UTSW 19 39,796,066 (GRCm39) missense probably damaging 1.00
R8848:Cyp2c40 UTSW 19 39,801,244 (GRCm39) missense unknown
R8915:Cyp2c40 UTSW 19 39,795,991 (GRCm39) missense probably benign 0.31
R8963:Cyp2c40 UTSW 19 39,755,926 (GRCm39) missense possibly damaging 0.82
R9132:Cyp2c40 UTSW 19 39,762,317 (GRCm39) missense probably damaging 1.00
R9159:Cyp2c40 UTSW 19 39,762,317 (GRCm39) missense probably damaging 1.00
R9168:Cyp2c40 UTSW 19 39,755,819 (GRCm39) missense probably benign
R9486:Cyp2c40 UTSW 19 39,796,050 (GRCm39) nonsense probably null
R9486:Cyp2c40 UTSW 19 39,755,808 (GRCm39) missense probably benign 0.00
R9489:Cyp2c40 UTSW 19 39,766,443 (GRCm39) missense probably damaging 1.00
R9605:Cyp2c40 UTSW 19 39,766,443 (GRCm39) missense probably damaging 1.00
R9772:Cyp2c40 UTSW 19 39,792,348 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAATCACCCTGTTCCTCTCAG -3'
(R):5'- CACTCAAACGATATGTGAGTGTGG -3'

Sequencing Primer
(F):5'- TCTCAGCCATTCCCACACATG -3'
(R):5'- ACGATATGTGAGTGTGGAAATATTG -3'
Posted On 2018-06-22