Mutagenetix > Incidental Mutation

Incidental Mutation 'R6591:Xpo1'

524590

Institutional Source

Beutler Lab

Gene Symbol

Xpo1

Ensembl Gene

ENSMUSG00000020290

Gene Name

exportin 1

Synonyms

Crm1

MMRRC Submission

044715-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6591 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23256041-23298249 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23286875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 718 (L718P)

Ref Sequence

ENSEMBL: ENSMUSP00000105178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]

AlphaFold

Q6P5F9

PDB Structure

Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020538
AA Change: L718P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: L718P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102869
AA Change: L718P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: L718P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	7.4e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102870
AA Change: L718P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: L718P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109551
AA Change: L718P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: L718P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149371

Predicted Effect

unknown
Transcript: ENSMUST00000150750
AA Change: L179P

SMART Domains

Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290
AA Change: L179P

Domain	Start	End	E-Value	Type
Blast:CRM1_C	97	136	3e-8	BLAST
Pfam:CRM1_C	171	233	4.3e-22	PFAM

Meta Mutation Damage Score

0.9739

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300009A05Rik	A	G	9: 63,398,954	Y90H	probably damaging	Het
Agk	A	G	6: 40,392,690	D337G	probably benign	Het
Amn	A	G	12: 111,275,397	H299R	possibly damaging	Het
Angptl4	A	G	17: 33,780,781		probably null	Het
AU040320	G	A	4: 126,836,670	M563I	possibly damaging	Het
Cachd1	T	C	4: 100,989,486	M1042T	probably benign	Het
Cd209c	T	A	8: 3,945,680	I41L	probably benign	Het
Ceacam12	T	A	7: 18,069,224	V185D	possibly damaging	Het
Chpt1	A	T	10: 88,485,900		probably benign	Het
Clca1	G	C	3: 145,013,883	A442G	probably damaging	Het
Cldn8	T	C	16: 88,562,535	I167M	possibly damaging	Het
Cln3	A	G	7: 126,579,434	V143A	possibly damaging	Het
Dusp11	T	C	6: 85,961,525	H4R	possibly damaging	Het
Ephb3	T	A	16: 21,214,473	F69Y	probably damaging	Het
Gm11099	A	T	2: 58,859,473		probably benign	Het
Grik2	A	T	10: 49,272,925	Y521*	probably null	Het
Igf2r	A	G	17: 12,689,008	L2143P	probably damaging	Het
Kcnk1	T	C	8: 126,025,231	V192A	probably benign	Het
Olfr1055	A	C	2: 86,347,419	S116A	probably damaging	Het
Olfr1254	A	T	2: 89,788,988	Y121*	probably null	Het
Parp3	A	G	9: 106,473,692	S329P	probably benign	Het
Pld3	A	T	7: 27,532,316	N483K	probably benign	Het
Rbm33	A	T	5: 28,352,546	E252D	probably damaging	Het
Ryr2	T	C	13: 11,594,723	T4406A	probably benign	Het
Sgsm3	A	G	15: 81,008,862	D380G	possibly damaging	Het
Sorl1	G	T	9: 42,002,567	D1355E	probably damaging	Het
Sptbn1	A	G	11: 30,113,984	S1945P	probably damaging	Het
Ube2m	A	T	7: 13,036,469	F70I	probably damaging	Het
Ube3b	A	G	5: 114,408,124	I664V	probably benign	Het
Ugt1a7c	A	G	1: 88,095,656	E179G	possibly damaging	Het
Vps50	T	C	6: 3,504,939		probably null	Het
Zfp354c	A	G	11: 50,814,775	I491T	probably benign	Het

Other mutations in Xpo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Xpo1	APN	11	23285094	missense	probably damaging	1.00
IGL01464:Xpo1	APN	11	23267703	missense	probably damaging	0.97
IGL01561:Xpo1	APN	11	23282706	missense	possibly damaging	0.76
IGL01630:Xpo1	APN	11	23285846	missense	probably benign	0.00
IGL01700:Xpo1	APN	11	23276422	splice site	probably benign
IGL02000:Xpo1	APN	11	23296003	missense	probably damaging	1.00
IGL02299:Xpo1	APN	11	23293915	splice site	probably benign
IGL02313:Xpo1	APN	11	23277065	missense	probably damaging	1.00
IGL02828:Xpo1	APN	11	23282593	missense	probably damaging	0.97
IGL03210:Xpo1	APN	11	23278834	missense	probably benign	0.01
IGL03329:Xpo1	APN	11	23284306	missense	probably benign
PIT1430001:Xpo1	UTSW	11	23276437	missense	possibly damaging	0.66
R0507:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R0594:Xpo1	UTSW	11	23280402	missense	probably damaging	1.00
R0706:Xpo1	UTSW	11	23280441	missense	probably benign	0.09
R0742:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R1385:Xpo1	UTSW	11	23261863	missense	probably damaging	0.96
R1478:Xpo1	UTSW	11	23291623	missense	probably damaging	0.99
R1483:Xpo1	UTSW	11	23284863	missense	probably benign	0.04
R1694:Xpo1	UTSW	11	23281399	missense	probably benign	0.12
R1775:Xpo1	UTSW	11	23271193	missense	probably benign
R1827:Xpo1	UTSW	11	23285155	missense	probably benign	0.00
R2262:Xpo1	UTSW	11	23284634	splice site	probably null
R2263:Xpo1	UTSW	11	23284634	splice site	probably null
R4510:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4511:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4840:Xpo1	UTSW	11	23278183	missense	probably damaging	1.00
R4901:Xpo1	UTSW	11	23281327	missense	possibly damaging	0.62
R5176:Xpo1	UTSW	11	23295977	missense	probably damaging	0.99
R5508:Xpo1	UTSW	11	23294645	missense	probably benign
R5927:Xpo1	UTSW	11	23268653	unclassified	probably benign
R5927:Xpo1	UTSW	11	23268656	unclassified	probably benign
R6110:Xpo1	UTSW	11	23287434	missense	probably damaging	0.99
R6421:Xpo1	UTSW	11	23291490	missense	possibly damaging	0.60
R6691:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6698:Xpo1	UTSW	11	23294040	missense	probably benign	0.01
R6958:Xpo1	UTSW	11	23285855	missense	probably benign
R7407:Xpo1	UTSW	11	23285823	missense	probably damaging	1.00
R7482:Xpo1	UTSW	11	23282544	missense	probably benign	0.00
R7624:Xpo1	UTSW	11	23282584	missense	probably damaging	0.99
R8335:Xpo1	UTSW	11	23280603	splice site	probably null
R8823:Xpo1	UTSW	11	23267752	missense	probably benign
R9128:Xpo1	UTSW	11	23285058	missense	probably damaging	1.00
R9232:Xpo1	UTSW	11	23282646	missense	probably benign
R9277:Xpo1	UTSW	11	23291550	missense	probably benign	0.17
Z1176:Xpo1	UTSW	11	23296080	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCTATAACCCAGGCCTTGTG -3'
(R):5'- CTTGGACCTTTTGACCCCAGAC -3'

Sequencing Primer
(F):5'- ATAACCCAGGCCTTGTGTTGTC -3'
(R):5'- TTTTGACCCCAGACAGCAGG -3'

Posted On

2018-06-22