Incidental Mutation 'R6591:Sptbn1'
ID 524592
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Name spectrin beta, non-erythrocytic 1
Synonyms beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic
MMRRC Submission 044715-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6591 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 30049395-30218175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30063984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1945 (S1945P)
Ref Sequence ENSEMBL: ENSMUSP00000011877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
AlphaFold Q62261
Predicted Effect probably damaging
Transcript: ENSMUST00000006629
AA Change: S1945P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: S1945P

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000011877
AA Change: S1945P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: S1945P

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102838
AA Change: S1932P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: S1932P

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124231
AA Change: S1945P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: S1945P

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127209
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,306,236 (GRCm39) Y90H probably damaging Het
Agk A G 6: 40,369,624 (GRCm39) D337G probably benign Het
Amn A G 12: 111,241,831 (GRCm39) H299R possibly damaging Het
Angptl4 A G 17: 33,999,755 (GRCm39) probably null Het
AU040320 G A 4: 126,730,463 (GRCm39) M563I possibly damaging Het
Cachd1 T C 4: 100,846,683 (GRCm39) M1042T probably benign Het
Cd209c T A 8: 3,995,680 (GRCm39) I41L probably benign Het
Ceacam12 T A 7: 17,803,149 (GRCm39) V185D possibly damaging Het
Chpt1 A T 10: 88,321,762 (GRCm39) probably benign Het
Clca3a1 G C 3: 144,719,644 (GRCm39) A442G probably damaging Het
Cldn8 T C 16: 88,359,423 (GRCm39) I167M possibly damaging Het
Cln3 A G 7: 126,178,606 (GRCm39) V143A possibly damaging Het
Dusp11 T C 6: 85,938,507 (GRCm39) H4R possibly damaging Het
Ephb3 T A 16: 21,033,223 (GRCm39) F69Y probably damaging Het
Gm11099 A T 2: 58,749,485 (GRCm39) probably benign Het
Grik2 A T 10: 49,149,021 (GRCm39) Y521* probably null Het
Igf2r A G 17: 12,907,895 (GRCm39) L2143P probably damaging Het
Kcnk1 T C 8: 126,751,970 (GRCm39) V192A probably benign Het
Or4a81 A T 2: 89,619,332 (GRCm39) Y121* probably null Het
Or8k53 A C 2: 86,177,763 (GRCm39) S116A probably damaging Het
Parp3 A G 9: 106,350,891 (GRCm39) S329P probably benign Het
Pld3 A T 7: 27,231,741 (GRCm39) N483K probably benign Het
Rbm33 A T 5: 28,557,544 (GRCm39) E252D probably damaging Het
Ryr2 T C 13: 11,609,609 (GRCm39) T4406A probably benign Het
Sgsm3 A G 15: 80,893,063 (GRCm39) D380G possibly damaging Het
Sorl1 G T 9: 41,913,863 (GRCm39) D1355E probably damaging Het
Ube2m A T 7: 12,770,396 (GRCm39) F70I probably damaging Het
Ube3b A G 5: 114,546,185 (GRCm39) I664V probably benign Het
Ugt1a7c A G 1: 88,023,378 (GRCm39) E179G possibly damaging Het
Vps50 T C 6: 3,504,939 (GRCm39) probably null Het
Xpo1 T C 11: 23,236,875 (GRCm39) L718P probably damaging Het
Zfp354c A G 11: 50,705,602 (GRCm39) I491T probably benign Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30,060,818 (GRCm39) nonsense probably null
IGL01098:Sptbn1 APN 11 30,109,385 (GRCm39) missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30,054,623 (GRCm39) missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30,095,979 (GRCm39) missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30,088,496 (GRCm39) missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30,050,659 (GRCm39) missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30,087,427 (GRCm39) missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30,067,871 (GRCm39) missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30,070,990 (GRCm39) missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30,092,129 (GRCm39) missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30,060,783 (GRCm39) missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30,060,783 (GRCm39) missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30,069,491 (GRCm39) missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30,092,293 (GRCm39) missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30,087,239 (GRCm39) missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30,147,747 (GRCm39) missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30,092,247 (GRCm39) missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30,073,855 (GRCm39) missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30,073,855 (GRCm39) missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30,092,289 (GRCm39) missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30,071,545 (GRCm39) missense probably benign
R0389:Sptbn1 UTSW 11 30,089,250 (GRCm39) missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30,099,576 (GRCm39) missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30,095,985 (GRCm39) missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30,100,008 (GRCm39) missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30,088,979 (GRCm39) missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30,067,903 (GRCm39) missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30,060,902 (GRCm39) missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30,089,016 (GRCm39) missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30,092,201 (GRCm39) missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30,071,591 (GRCm39) missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30,070,785 (GRCm39) missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30,088,637 (GRCm39) missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30,063,909 (GRCm39) missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30,071,498 (GRCm39) missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30,087,301 (GRCm39) missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30,070,783 (GRCm39) missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30,092,245 (GRCm39) missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30,109,371 (GRCm39) missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30,086,124 (GRCm39) missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30,064,781 (GRCm39) missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30,092,414 (GRCm39) missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30,054,469 (GRCm39) missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30,054,559 (GRCm39) missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30,109,293 (GRCm39) critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30,088,360 (GRCm39) splice site probably benign
R2312:Sptbn1 UTSW 11 30,104,249 (GRCm39) missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30,169,686 (GRCm39) missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30,090,593 (GRCm39) missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30,087,335 (GRCm39) missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30,092,329 (GRCm39) missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30,089,114 (GRCm39) missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30,169,597 (GRCm39) missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30,050,660 (GRCm39) missense probably benign
R4707:Sptbn1 UTSW 11 30,087,197 (GRCm39) missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30,104,297 (GRCm39) missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30,067,759 (GRCm39) missense probably benign
R4824:Sptbn1 UTSW 11 30,068,295 (GRCm39) missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30,092,353 (GRCm39) missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30,074,016 (GRCm39) missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30,063,854 (GRCm39) critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30,071,510 (GRCm39) missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30,087,364 (GRCm39) missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30,050,520 (GRCm39) missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30,087,560 (GRCm39) missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30,093,174 (GRCm39) missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30,094,113 (GRCm39) missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30,095,941 (GRCm39) missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30,095,925 (GRCm39) missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30,073,978 (GRCm39) missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30,086,136 (GRCm39) missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30,074,873 (GRCm39) missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30,068,464 (GRCm39) missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30,087,403 (GRCm39) missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30,109,443 (GRCm39) nonsense probably null
R6226:Sptbn1 UTSW 11 30,086,054 (GRCm39) missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30,050,660 (GRCm39) missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30,089,429 (GRCm39) missense possibly damaging 0.56
R6616:Sptbn1 UTSW 11 30,074,030 (GRCm39) missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30,063,984 (GRCm39) missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30,067,859 (GRCm39) missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30,064,787 (GRCm39) missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30,096,777 (GRCm39) missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30,088,634 (GRCm39) missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30,092,187 (GRCm39) missense probably benign 0.27
R6998:Sptbn1 UTSW 11 30,050,633 (GRCm39) missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30,053,323 (GRCm39) missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30,087,119 (GRCm39) missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30,064,859 (GRCm39) missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30,067,798 (GRCm39) nonsense probably null
R7379:Sptbn1 UTSW 11 30,089,292 (GRCm39) missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30,092,142 (GRCm39) missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30,088,455 (GRCm39) missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30,088,832 (GRCm39) missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30,104,320 (GRCm39) missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30,092,153 (GRCm39) missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30,079,601 (GRCm39) missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30,086,048 (GRCm39) missense probably damaging 1.00
R8060:Sptbn1 UTSW 11 30,051,616 (GRCm39) missense probably damaging 0.99
R8116:Sptbn1 UTSW 11 30,089,117 (GRCm39) missense probably damaging 1.00
R8169:Sptbn1 UTSW 11 30,147,783 (GRCm39) missense possibly damaging 0.62
R8208:Sptbn1 UTSW 11 30,074,972 (GRCm39) missense probably damaging 1.00
R8247:Sptbn1 UTSW 11 30,063,906 (GRCm39) missense possibly damaging 0.84
R8412:Sptbn1 UTSW 11 30,088,457 (GRCm39) missense probably damaging 1.00
R8470:Sptbn1 UTSW 11 30,070,758 (GRCm39) missense possibly damaging 0.78
R8544:Sptbn1 UTSW 11 30,169,750 (GRCm39) start gained probably benign
R8674:Sptbn1 UTSW 11 30,089,352 (GRCm39) missense possibly damaging 0.73
R8846:Sptbn1 UTSW 11 30,075,009 (GRCm39) missense possibly damaging 0.77
R8889:Sptbn1 UTSW 11 30,067,800 (GRCm39) missense probably benign 0.03
R8892:Sptbn1 UTSW 11 30,067,800 (GRCm39) missense probably benign 0.03
R8927:Sptbn1 UTSW 11 30,088,962 (GRCm39) missense probably damaging 1.00
R8928:Sptbn1 UTSW 11 30,088,962 (GRCm39) missense probably damaging 1.00
R8975:Sptbn1 UTSW 11 30,073,869 (GRCm39) missense possibly damaging 0.86
R9115:Sptbn1 UTSW 11 30,087,526 (GRCm39) missense probably damaging 1.00
R9127:Sptbn1 UTSW 11 30,104,356 (GRCm39) missense probably damaging 1.00
R9193:Sptbn1 UTSW 11 30,087,551 (GRCm39) missense possibly damaging 0.77
R9237:Sptbn1 UTSW 11 30,096,803 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30,147,787 (GRCm39) missense probably benign 0.13
Z1176:Sptbn1 UTSW 11 30,087,439 (GRCm39) missense probably damaging 1.00
Z1177:Sptbn1 UTSW 11 30,070,659 (GRCm39) missense probably benign 0.27
Z1177:Sptbn1 UTSW 11 30,064,734 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTTCAAAGACACAGTTG -3'
(R):5'- ACCGAGTTAGCCAGTCCTAAG -3'

Sequencing Primer
(F):5'- AATCCTTTTACATGCCAACACTGG -3'
(R):5'- CCGAGTTAGCCAGTCCTAAGTTAAG -3'
Posted On 2018-06-22