Mutagenetix > Incidental Mutation

Incidental Mutation 'R6623:Lnx2'

524597

Institutional Source

Beutler Lab

Gene Symbol

Lnx2

Ensembl Gene

ENSMUSG00000016520

Gene Name

ligand of numb-protein X 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6623 (G1)

Quality Score

180.009

Status

Validated

Chromosome

Chromosomal Location

147016655-147076586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 147024487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 545 (V545A)

Ref Sequence

ENSEMBL: ENSMUSP00000016664 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016664]

AlphaFold

Q91XL2

Predicted Effect

probably damaging
Transcript: ENSMUST00000016664
AA Change: V545A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000016664
Gene: ENSMUSG00000016520
AA Change: V545A

Domain	Start	End	E-Value	Type
RING	51	88	2.06e-6	SMART
low complexity region	103	114	N/A	INTRINSIC
PDZ	242	317	2.25e-17	SMART
PDZ	348	421	2.97e-17	SMART
PDZ	474	553	7.37e-13	SMART
PDZ	606	683	1.27e-16	SMART

Meta Mutation Damage Score

0.7059

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

100% (29/29)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	A	T	2: 148,850,762	I40K	probably benign	Het
Abcc10	T	C	17: 46,323,462	K460E	probably damaging	Het
Acaca	A	C	11: 84,371,499		probably null	Het
Adamts1	A	G	16: 85,795,637	S628P	probably benign	Het
Ankrd13a	A	G	5: 114,786,757	N101S	probably benign	Het
Asic5	G	A	3: 82,008,585	V281M	probably damaging	Het
Atxn7	T	C	14: 14,099,972	S553P	probably damaging	Het
Fndc3c1	G	C	X: 106,435,073	L724V	possibly damaging	Homo
Hmcn1	A	G	1: 150,758,306	F843S	probably benign	Het
Igkv10-96	T	G	6: 68,632,174	S46R	probably damaging	Het
Itfg2	G	T	6: 128,411,657	A289D	probably damaging	Het
Klc1	C	A	12: 111,806,041	N597K	probably damaging	Het
Map3k11	A	G	19: 5,695,603	I344V	probably damaging	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myrf	C	A	19: 10,223,359	A317S	probably benign	Het
Ncoa2	A	T	1: 13,181,297	C251S	probably damaging	Het
Olfr556	T	G	7: 102,670,034	M38R	possibly damaging	Het
Pcdhb12	C	T	18: 37,437,658	T619I	possibly damaging	Het
Plxna1	A	T	6: 89,322,771	M1672K	probably damaging	Het
Prl	G	T	13: 27,061,509	V72L	probably benign	Het
Prokr2	G	T	2: 132,373,574	N161K	probably damaging	Het
Ryr2	T	C	13: 11,710,065	D2454G	probably damaging	Het
Slc2a12	T	A	10: 22,664,900	M218K	probably damaging	Het
Sorcs3	C	T	19: 48,788,505	A992V	probably benign	Het
Stxbp2	T	C	8: 3,632,561	I50T	probably damaging	Het
Supt20	A	G	3: 54,718,294	I570M	possibly damaging	Het
Sv2b	T	A	7: 75,206,384	I53F	probably damaging	Het
Vmn1r113	T	A	7: 20,788,066	M261K	probably benign	Het
Vmn1r217	T	A	13: 23,114,676	I19F	possibly damaging	Het
Vmn2r45	T	C	7: 8,471,501	T843A	probably benign	Het
Vmn2r69	T	A	7: 85,407,101	I610L	possibly damaging	Het

Other mutations in Lnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02593:Lnx2	APN	5	147033015	missense	possibly damaging	0.81
IGL02657:Lnx2	APN	5	147028174	missense	probably damaging	1.00
IGL02820:Lnx2	APN	5	147042067	missense	probably damaging	0.98
R0051:Lnx2	UTSW	5	147029353	missense	probably damaging	0.96
R0389:Lnx2	UTSW	5	147019040	missense	possibly damaging	0.51
R0482:Lnx2	UTSW	5	147018961	missense	probably damaging	0.99
R1601:Lnx2	UTSW	5	147033519	missense	probably damaging	0.99
R1604:Lnx2	UTSW	5	147029325	missense	probably benign	0.02
R1647:Lnx2	UTSW	5	147027342	missense	probably benign	0.04
R3001:Lnx2	UTSW	5	147019015	missense	probably benign	0.00
R3002:Lnx2	UTSW	5	147019015	missense	probably benign	0.00
R4734:Lnx2	UTSW	5	147029137	missense	probably damaging	1.00
R4960:Lnx2	UTSW	5	147019040	missense	probably benign	0.09
R5387:Lnx2	UTSW	5	147028154	missense	probably benign	0.00
R5689:Lnx2	UTSW	5	147029151	missense	probably damaging	1.00
R5950:Lnx2	UTSW	5	147024350	critical splice donor site	probably null
R6161:Lnx2	UTSW	5	147042026	splice site	probably null
R7086:Lnx2	UTSW	5	147020178	splice site	probably null
R7320:Lnx2	UTSW	5	147020133	missense	possibly damaging	0.71
R7701:Lnx2	UTSW	5	147024523	missense	probably damaging	1.00
R7887:Lnx2	UTSW	5	147019043	missense	probably damaging	1.00
R8153:Lnx2	UTSW	5	147028096	missense	probably benign
R8267:Lnx2	UTSW	5	147029091	missense	probably damaging	1.00
R8298:Lnx2	UTSW	5	147024517	missense	probably benign	0.05
R8384:Lnx2	UTSW	5	147029328	missense	probably benign	0.01
R8446:Lnx2	UTSW	5	147033359	missense	probably benign
R8971:Lnx2	UTSW	5	147033426	missense	probably benign
R9378:Lnx2	UTSW	5	147024370	missense	probably benign	0.16
R9468:Lnx2	UTSW	5	147042479	start gained	probably benign
R9711:Lnx2	UTSW	5	147024566	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCACTGGGTGAGTTAACC -3'
(R):5'- CCATCAATTAGTTGGCAAGCAG -3'

Sequencing Primer
(F):5'- CACTGGGTGAGTTAACCGTGTAAC -3'
(R):5'- AGGAGCTTCGGGGAGTCAC -3'

Posted On

2018-06-22