Mutagenetix > Incidental Mutation

Incidental Mutation 'R6591:Igf2r'

524604

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

044715-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R6591 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12689008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 2143 (L2143P)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: L2143P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: L2143P

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.9285

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300009A05Rik	A	G	9: 63,398,954 (GRCm38)	Y90H	probably damaging	Het
Agk	A	G	6: 40,392,690 (GRCm38)	D337G	probably benign	Het
Amn	A	G	12: 111,275,397 (GRCm38)	H299R	possibly damaging	Het
Angptl4	A	G	17: 33,780,781 (GRCm38)		probably null	Het
AU040320	G	A	4: 126,836,670 (GRCm38)	M563I	possibly damaging	Het
Cachd1	T	C	4: 100,989,486 (GRCm38)	M1042T	probably benign	Het
Cd209c	T	A	8: 3,945,680 (GRCm38)	I41L	probably benign	Het
Ceacam12	T	A	7: 18,069,224 (GRCm38)	V185D	possibly damaging	Het
Chpt1	A	T	10: 88,485,900 (GRCm38)		probably benign	Het
Clca1	G	C	3: 145,013,883 (GRCm38)	A442G	probably damaging	Het
Cldn8	T	C	16: 88,562,535 (GRCm38)	I167M	possibly damaging	Het
Cln3	A	G	7: 126,579,434 (GRCm38)	V143A	possibly damaging	Het
Dusp11	T	C	6: 85,961,525 (GRCm38)	H4R	possibly damaging	Het
Ephb3	T	A	16: 21,214,473 (GRCm38)	F69Y	probably damaging	Het
Gm11099	A	T	2: 58,859,473 (GRCm38)		probably benign	Het
Grik2	A	T	10: 49,272,925 (GRCm38)	Y521*	probably null	Het
Kcnk1	T	C	8: 126,025,231 (GRCm38)	V192A	probably benign	Het
Olfr1055	A	C	2: 86,347,419 (GRCm38)	S116A	probably damaging	Het
Olfr1254	A	T	2: 89,788,988 (GRCm38)	Y121*	probably null	Het
Parp3	A	G	9: 106,473,692 (GRCm38)	S329P	probably benign	Het
Pld3	A	T	7: 27,532,316 (GRCm38)	N483K	probably benign	Het
Rbm33	A	T	5: 28,352,546 (GRCm38)	E252D	probably damaging	Het
Ryr2	T	C	13: 11,594,723 (GRCm38)	T4406A	probably benign	Het
Sgsm3	A	G	15: 81,008,862 (GRCm38)	D380G	possibly damaging	Het
Sorl1	G	T	9: 42,002,567 (GRCm38)	D1355E	probably damaging	Het
Sptbn1	A	G	11: 30,113,984 (GRCm38)	S1945P	probably damaging	Het
Ube2m	A	T	7: 13,036,469 (GRCm38)	F70I	probably damaging	Het
Ube3b	A	G	5: 114,408,124 (GRCm38)	I664V	probably benign	Het
Ugt1a7c	A	G	1: 88,095,656 (GRCm38)	E179G	possibly damaging	Het
Vps50	T	C	6: 3,504,939 (GRCm38)		probably null	Het
Xpo1	T	C	11: 23,286,875 (GRCm38)	L718P	probably damaging	Het
Zfp354c	A	G	11: 50,814,775 (GRCm38)	I491T	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,713,990 (GRCm38)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,739,328 (GRCm38)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,700,358 (GRCm38)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,683,867 (GRCm38)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,704,775 (GRCm38)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,695,374 (GRCm38)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,704,349 (GRCm38)	missense	probably benign
IGL01557:Igf2r	APN	17	12,704,635 (GRCm38)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,683,985 (GRCm38)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,725,415 (GRCm38)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,701,313 (GRCm38)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,683,822 (GRCm38)	missense	probably benign
IGL01839:Igf2r	APN	17	12,705,022 (GRCm38)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,714,911 (GRCm38)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,704,338 (GRCm38)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,693,192 (GRCm38)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,702,005 (GRCm38)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,698,516 (GRCm38)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,748,763 (GRCm38)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,712,087 (GRCm38)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,719,883 (GRCm38)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,692,723 (GRCm38)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,694,120 (GRCm38)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,710,746 (GRCm38)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,726,676 (GRCm38)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,716,672 (GRCm38)	missense	probably damaging	1.00
blunt	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
brusque	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
gruff	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
outlier	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,691,962 (GRCm38)	missense	probably benign
R0165:Igf2r	UTSW	17	12,698,527 (GRCm38)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,683,948 (GRCm38)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,692,064 (GRCm38)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,717,274 (GRCm38)	splice site	probably null
R0722:Igf2r	UTSW	17	12,715,495 (GRCm38)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,692,101 (GRCm38)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,694,124 (GRCm38)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,717,269 (GRCm38)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,691,285 (GRCm38)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,726,309 (GRCm38)	missense	probably benign
R1693:Igf2r	UTSW	17	12,704,316 (GRCm38)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,697,441 (GRCm38)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,704,270 (GRCm38)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,733,903 (GRCm38)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,692,738 (GRCm38)	missense	probably benign
R2060:Igf2r	UTSW	17	12,701,319 (GRCm38)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,698,251 (GRCm38)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,722,208 (GRCm38)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,715,943 (GRCm38)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,722,311 (GRCm38)	splice site	probably null
R2696:Igf2r	UTSW	17	12,695,344 (GRCm38)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,709,468 (GRCm38)	missense	probably benign
R3930:Igf2r	UTSW	17	12,705,829 (GRCm38)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,748,751 (GRCm38)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,702,254 (GRCm38)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,703,465 (GRCm38)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,684,126 (GRCm38)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,701,353 (GRCm38)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,691,877 (GRCm38)	splice site	probably null
R4980:Igf2r	UTSW	17	12,703,360 (GRCm38)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,725,416 (GRCm38)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,693,145 (GRCm38)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,739,334 (GRCm38)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,717,367 (GRCm38)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,698,352 (GRCm38)	splice site	probably null
R5794:Igf2r	UTSW	17	12,709,445 (GRCm38)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,714,113 (GRCm38)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,683,900 (GRCm38)	missense	probably benign
R6396:Igf2r	UTSW	17	12,714,090 (GRCm38)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,701,250 (GRCm38)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6599:Igf2r	UTSW	17	12,698,618 (GRCm38)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,714,944 (GRCm38)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,714,082 (GRCm38)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,703,376 (GRCm38)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,697,341 (GRCm38)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,718,718 (GRCm38)	missense	probably benign
R7030:Igf2r	UTSW	17	12,733,866 (GRCm38)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,698,325 (GRCm38)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,704,323 (GRCm38)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,714,116 (GRCm38)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,703,484 (GRCm38)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,698,228 (GRCm38)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,710,645 (GRCm38)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,698,273 (GRCm38)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,735,991 (GRCm38)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,739,369 (GRCm38)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,748,704 (GRCm38)	missense	probably benign
R8022:Igf2r	UTSW	17	12,718,795 (GRCm38)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,701,238 (GRCm38)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,692,071 (GRCm38)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,733,860 (GRCm38)	missense	probably benign
R8359:Igf2r	UTSW	17	12,683,861 (GRCm38)	missense	probably benign
R8500:Igf2r	UTSW	17	12,709,441 (GRCm38)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,704,313 (GRCm38)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,704,637 (GRCm38)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,701,244 (GRCm38)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,726,772 (GRCm38)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,716,650 (GRCm38)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,751,293 (GRCm38)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,691,213 (GRCm38)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,739,351 (GRCm38)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,695,353 (GRCm38)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,705,759 (GRCm38)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,698,328 (GRCm38)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,686,754 (GRCm38)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,694,140 (GRCm38)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,726,701 (GRCm38)	missense	probably benign
X0028:Igf2r	UTSW	17	12,704,913 (GRCm38)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,697,399 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGACAAAGAAGCAGTCCTTTTGC -3'
(R):5'- AAGGACCCTTAAGAACCCGG -3'

Sequencing Primer
(F):5'- CAGTCCTTTTGCTTGGTGTAAG -3'
(R):5'- AGGCCTCTCCAGCTATGTGTG -3'

Posted On

2018-06-22