Incidental Mutation 'R6623:Slc2a12'
ID524615
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6623 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22664900 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 218 (M218K)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably damaging
Transcript: ENSMUST00000042261
AA Change: M218K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: M218K

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159174
Meta Mutation Damage Score 0.2598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A T 2: 148,850,762 I40K probably benign Het
Abcc10 T C 17: 46,323,462 K460E probably damaging Het
Acaca A C 11: 84,371,499 probably null Het
Adamts1 A G 16: 85,795,637 S628P probably benign Het
Ankrd13a A G 5: 114,786,757 N101S probably benign Het
Asic5 G A 3: 82,008,585 V281M probably damaging Het
Atxn7 T C 14: 14,099,972 S553P probably damaging Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Homo
Hmcn1 A G 1: 150,758,306 F843S probably benign Het
Igkv10-96 T G 6: 68,632,174 S46R probably damaging Het
Itfg2 G T 6: 128,411,657 A289D probably damaging Het
Klc1 C A 12: 111,806,041 N597K probably damaging Het
Lnx2 A G 5: 147,024,487 V545A probably damaging Het
Map3k11 A G 19: 5,695,603 I344V probably damaging Het
Muc6 G A 7: 141,639,559 probably benign Het
Myrf C A 19: 10,223,359 A317S probably benign Het
Ncoa2 A T 1: 13,181,297 C251S probably damaging Het
Olfr556 T G 7: 102,670,034 M38R possibly damaging Het
Pcdhb12 C T 18: 37,437,658 T619I possibly damaging Het
Plxna1 A T 6: 89,322,771 M1672K probably damaging Het
Prl G T 13: 27,061,509 V72L probably benign Het
Prokr2 G T 2: 132,373,574 N161K probably damaging Het
Ryr2 T C 13: 11,710,065 D2454G probably damaging Het
Sorcs3 C T 19: 48,788,505 A992V probably benign Het
Stxbp2 T C 8: 3,632,561 I50T probably damaging Het
Supt20 A G 3: 54,718,294 I570M possibly damaging Het
Sv2b T A 7: 75,206,384 I53F probably damaging Het
Vmn1r113 T A 7: 20,788,066 M261K probably benign Het
Vmn1r217 T A 13: 23,114,676 I19F possibly damaging Het
Vmn2r45 T C 7: 8,471,501 T843A probably benign Het
Vmn2r69 T A 7: 85,407,101 I610L possibly damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
R7592:Slc2a12 UTSW 10 22664903 missense probably damaging 1.00
R7641:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
R7674:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
R7736:Slc2a12 UTSW 10 22664818 missense probably damaging 1.00
R7822:Slc2a12 UTSW 10 22664669 missense probably damaging 1.00
Z1177:Slc2a12 UTSW 10 22645241 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTACATTGCGGAAATTGCCC -3'
(R):5'- TACCAGTGTCAGACCTATCAGG -3'

Sequencing Primer
(F):5'- CCCCAACACAGAAGAGGAC -3'
(R):5'- CAGTGTCAGACCTATCAGGATTCTG -3'
Posted On2018-06-22