Incidental Mutation 'R6592:Gpr149'
ID524620
Institutional Source Beutler Lab
Gene Symbol Gpr149
Ensembl Gene ENSMUSG00000043441
Gene NameG protein-coupled receptor 149
SynonymsPGR10, R35, Ieda, 9630018L10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6592 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location62529077-62605140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62530540 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 732 (D732G)
Ref Sequence ENSEMBL: ENSMUSP00000060893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058535]
Predicted Effect probably benign
Transcript: ENSMUST00000058535
AA Change: D732G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060893
Gene: ENSMUSG00000043441
AA Change: D732G

DomainStartEndE-ValueType
Pfam:7tm_1 52 363 7.2e-7 PFAM
coiled coil region 694 730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 94% (31/33)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit increased fertility with increased litter size and frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,718 V340A possibly damaging Het
Btbd17 T C 11: 114,791,476 Y470C probably damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cyp4v3 A T 8: 45,306,981 N511K probably benign Het
Efcab5 G T 11: 77,113,610 Q1097K possibly damaging Het
Epha7 T C 4: 28,813,482 probably null Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fnip2 T C 3: 79,481,708 Q572R probably benign Het
Gm17430 C T 18: 9,726,514 V53I probably benign Het
Hdlbp A G 1: 93,412,361 probably null Het
Herc2 A G 7: 56,207,690 probably null Het
Htt C T 5: 34,877,044 T1953I possibly damaging Het
Lgmn C T 12: 102,404,270 V134I probably damaging Het
Lysmd1 A G 3: 95,137,886 S148G probably benign Het
Man2a2 T C 7: 80,353,199 D1054G probably damaging Het
Mcph1 A G 8: 18,668,967 T640A probably damaging Het
Nat10 T C 2: 103,754,150 E94G probably null Het
Olfr110 T A 17: 37,499,097 W149R probably damaging Het
Olfr1200 G A 2: 88,768,127 H63Y probably damaging Het
Pgm3 A G 9: 86,559,443 V367A possibly damaging Het
Ppp1r1a A C 15: 103,531,372 D164E probably damaging Het
Proca1 G T 11: 78,204,953 S137I probably benign Het
Serinc5 T C 13: 92,708,126 F459L possibly damaging Het
Slc12a8 T C 16: 33,617,256 probably null Het
Slc51a T C 16: 32,475,803 D321G probably damaging Het
Tchhl1 T A 3: 93,470,809 D273E probably damaging Het
Tlk1 G A 2: 70,714,153 R713C probably damaging Het
Tmem211 A G 5: 113,234,463 Y34C probably damaging Het
Tpr T C 1: 150,411,905 I465T possibly damaging Het
Usp1 A G 4: 98,926,519 I5M possibly damaging Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Other mutations in Gpr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Gpr149 APN 3 62530673 missense probably damaging 1.00
IGL01339:Gpr149 APN 3 62604297 missense probably damaging 1.00
IGL01399:Gpr149 APN 3 62604431 missense probably damaging 1.00
IGL01954:Gpr149 APN 3 62530927 missense probably benign 0.36
IGL02115:Gpr149 APN 3 62594915 missense probably benign 0.02
IGL02218:Gpr149 APN 3 62530531 utr 3 prime probably benign
IGL02592:Gpr149 APN 3 62603810 missense possibly damaging 0.75
IGL03393:Gpr149 APN 3 62603945 missense probably benign 0.15
R0578:Gpr149 UTSW 3 62602689 missense possibly damaging 0.81
R1173:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1174:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1175:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1432:Gpr149 UTSW 3 62531018 missense probably damaging 1.00
R1484:Gpr149 UTSW 3 62595171 missense probably benign 0.00
R1972:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R1973:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R2180:Gpr149 UTSW 3 62604068 missense probably damaging 1.00
R2241:Gpr149 UTSW 3 62604053 missense probably benign 0.00
R3118:Gpr149 UTSW 3 62595022 missense probably benign 0.00
R3547:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R3548:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R4206:Gpr149 UTSW 3 62604503 missense possibly damaging 0.92
R4332:Gpr149 UTSW 3 62604373 missense possibly damaging 0.93
R4531:Gpr149 UTSW 3 62602678 missense probably benign 0.00
R4557:Gpr149 UTSW 3 62530870 missense probably damaging 1.00
R4557:Gpr149 UTSW 3 62604497 missense probably benign 0.02
R4593:Gpr149 UTSW 3 62602730 intron probably benign
R5397:Gpr149 UTSW 3 62530805 missense probably damaging 1.00
R6642:Gpr149 UTSW 3 62530574 missense probably damaging 1.00
R6845:Gpr149 UTSW 3 62604521 missense possibly damaging 0.58
R7303:Gpr149 UTSW 3 62595070 missense possibly damaging 0.59
R7659:Gpr149 UTSW 3 62603835 missense probably benign 0.01
R7682:Gpr149 UTSW 3 62530739 missense probably damaging 1.00
R7803:Gpr149 UTSW 3 62530715 missense probably damaging 1.00
R7904:Gpr149 UTSW 3 62594935 missense probably benign 0.00
R7943:Gpr149 UTSW 3 62530711 missense probably damaging 1.00
Z1177:Gpr149 UTSW 3 62603959 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TATGTATGCACTATGGCAGGTC -3'
(R):5'- TCACGGAAGGAAAACAGATTCGTC -3'

Sequencing Primer
(F):5'- TATGGCAGGTCATCCAAACAAATAG -3'
(R):5'- GGAAAACAGATTCGTCTCCTGCG -3'
Posted On2018-06-22